Incidental Mutation 'R8537:Hnrnpu'
ID 659267
Institutional Source Beutler Lab
Gene Symbol Hnrnpu
Ensembl Gene ENSMUSG00000039630
Gene Name heterogeneous nuclear ribonucleoprotein U
Synonyms Sp120, scaffold attachment factor A, Hnrpu
MMRRC Submission 067891-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 178148673-178165362 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 178161199 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000037748] [ENSMUST00000161769]
AlphaFold Q8VEK3
Predicted Effect unknown
Transcript: ENSMUST00000037748
AA Change: I320V
SMART Domains Protein: ENSMUSP00000047571
Gene: ENSMUSG00000039630
AA Change: I320V

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 2e-30 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 791 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161769
AA Change: I320V
SMART Domains Protein: ENSMUSP00000124147
Gene: ENSMUSG00000039630
AA Change: I320V

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 6.7e-31 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 773 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188044
Predicted Effect probably benign
Transcript: ENSMUST00000189450
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they form complexes with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene contains a RNA binding domain and scaffold-associated region (SAR)-specific bipartite DNA-binding domain. This protein is also thought to be involved in the packaging of hnRNA into large ribonucleoprotein complexes. During apoptosis, this protein is cleaved in a caspase-dependent way. Cleavage occurs at the SALD site, resulting in a loss of DNA-binding activity and a concomitant detachment of this protein from nuclear structural sites. But this cleavage does not affect the function of the encoded protein in RNA metabolism. At least two alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality, delayed embryonic development, and failure of chorioallantoic fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,684,491 (GRCm39) D1790V probably damaging Het
Aopep A T 13: 63,338,364 (GRCm39) E579V probably damaging Het
Avl9 T A 6: 56,705,644 (GRCm39) Y175* probably null Het
Bmp2 A T 2: 133,403,202 (GRCm39) D251V probably damaging Het
Camsap2 T A 1: 136,204,943 (GRCm39) K1191N probably damaging Het
Ccdc102a A C 8: 95,632,684 (GRCm39) F431C probably benign Het
Ccdc186 T C 19: 56,798,677 (GRCm39) I270M probably damaging Het
Copb2 A G 9: 98,469,672 (GRCm39) Q851R probably null Het
Cyp11b2 C T 15: 74,728,016 (GRCm39) R22K probably benign Het
Ddx50 A G 10: 62,478,628 (GRCm39) F186S probably damaging Het
Dhx38 T C 8: 110,280,012 (GRCm39) Y926C probably damaging Het
Dmrt2 T C 19: 25,651,300 (GRCm39) M162T possibly damaging Het
Dnah10 G T 5: 124,893,164 (GRCm39) G3309V probably damaging Het
Dnajb2 T C 1: 75,216,242 (GRCm39) F107S probably damaging Het
Dock8 T A 19: 25,107,870 (GRCm39) S867T probably benign Het
Eif2ak1 C A 5: 143,835,887 (GRCm39) T526K probably damaging Het
Gnas T C 2: 174,140,394 (GRCm39) S188P possibly damaging Het
Gpam T C 19: 55,084,671 (GRCm39) D36G probably benign Het
Gucy2e C A 11: 69,127,179 (GRCm39) R98L probably benign Het
Hmcn2 C A 2: 31,281,088 (GRCm39) L1867I probably benign Het
Icos A G 1: 61,033,101 (GRCm39) D100G probably damaging Het
Ifi203 A T 1: 173,756,472 (GRCm39) probably benign Het
Ift46 T A 9: 44,695,280 (GRCm39) L92Q probably damaging Het
Kcnip2 C T 19: 45,804,169 (GRCm39) probably null Het
Lgr5 T C 10: 115,288,307 (GRCm39) Y779C probably damaging Het
Ltk G T 2: 119,588,588 (GRCm39) P287Q probably benign Het
Mapk8ip3 A T 17: 25,120,652 (GRCm39) C852* probably null Het
Mmp27 A G 9: 7,579,776 (GRCm39) M443V probably benign Het
Muc6 T C 7: 141,234,184 (GRCm39) D769G probably benign Het
Myo7b T C 18: 32,110,142 (GRCm39) I1107V probably benign Het
Nebl T A 2: 17,355,520 (GRCm39) H211L probably benign Het
Oaz3 T A 3: 94,343,742 (GRCm39) K40N probably damaging Het
Or5as1 T A 2: 86,980,382 (GRCm39) T208S probably benign Het
Or7e169 T A 9: 19,757,848 (GRCm39) E22D probably damaging Het
Osbpl10 G T 9: 115,058,977 (GRCm39) A718S probably benign Het
Ppp3ca T A 3: 136,503,619 (GRCm39) I64K possibly damaging Het
Prlr T C 15: 10,314,266 (GRCm39) probably benign Het
Rab3ip A G 10: 116,746,059 (GRCm39) I424T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,121 (GRCm39) probably benign Het
Sec62 G T 3: 30,872,961 (GRCm39) R348L unknown Het
Sema5b C T 16: 35,471,979 (GRCm39) A479V possibly damaging Het
Shank3 T C 15: 89,416,418 (GRCm39) I222T probably damaging Het
Sp1 C T 15: 102,316,964 (GRCm39) T154I possibly damaging Het
Spata31e1 A G 13: 49,940,108 (GRCm39) V534A possibly damaging Het
Srek1 A G 13: 103,888,957 (GRCm39) probably benign Het
Tmem129 A G 5: 33,812,920 (GRCm39) S143P possibly damaging Het
Tmem202 A T 9: 59,426,929 (GRCm39) C194S probably benign Het
Tmprss15 A T 16: 78,884,403 (GRCm39) I93K probably damaging Het
Ttn A G 2: 76,606,653 (GRCm39) Y16340H probably damaging Het
Uck1 C A 2: 32,150,153 (GRCm39) probably benign Het
Other mutations in Hnrnpu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03117:Hnrnpu APN 1 178,158,339 (GRCm39) unclassified probably benign
R1136:Hnrnpu UTSW 1 178,158,790 (GRCm39) unclassified probably benign
R1205:Hnrnpu UTSW 1 178,159,734 (GRCm39) unclassified probably benign
R1317:Hnrnpu UTSW 1 178,157,822 (GRCm39) unclassified probably benign
R1318:Hnrnpu UTSW 1 178,157,822 (GRCm39) unclassified probably benign
R1778:Hnrnpu UTSW 1 178,152,806 (GRCm39) critical splice donor site probably benign
R3160:Hnrnpu UTSW 1 178,158,690 (GRCm39) unclassified probably benign
R3161:Hnrnpu UTSW 1 178,158,690 (GRCm39) unclassified probably benign
R3162:Hnrnpu UTSW 1 178,158,690 (GRCm39) unclassified probably benign
R3162:Hnrnpu UTSW 1 178,158,690 (GRCm39) unclassified probably benign
R4408:Hnrnpu UTSW 1 178,158,368 (GRCm39) unclassified probably benign
R4667:Hnrnpu UTSW 1 178,159,746 (GRCm39) unclassified probably benign
R4833:Hnrnpu UTSW 1 178,161,459 (GRCm39) unclassified probably benign
R4906:Hnrnpu UTSW 1 178,156,938 (GRCm39) intron probably benign
R4923:Hnrnpu UTSW 1 178,159,017 (GRCm39) unclassified probably benign
R5000:Hnrnpu UTSW 1 178,156,941 (GRCm39) intron probably benign
R5256:Hnrnpu UTSW 1 178,163,458 (GRCm39) missense unknown
R5307:Hnrnpu UTSW 1 178,164,877 (GRCm39) missense unknown
R5911:Hnrnpu UTSW 1 178,157,737 (GRCm39) unclassified probably benign
R6931:Hnrnpu UTSW 1 178,158,997 (GRCm39) unclassified probably benign
R7061:Hnrnpu UTSW 1 178,163,691 (GRCm39) missense unknown
R7077:Hnrnpu UTSW 1 178,159,756 (GRCm39) missense unknown
R7391:Hnrnpu UTSW 1 178,164,643 (GRCm39) missense unknown
R7423:Hnrnpu UTSW 1 178,156,849 (GRCm39) intron probably benign
R7991:Hnrnpu UTSW 1 178,159,871 (GRCm39) missense unknown
R8037:Hnrnpu UTSW 1 178,159,917 (GRCm39) missense unknown
R8161:Hnrnpu UTSW 1 178,165,067 (GRCm39) missense possibly damaging 0.95
R8265:Hnrnpu UTSW 1 178,159,725 (GRCm39) missense unknown
Z1176:Hnrnpu UTSW 1 178,159,780 (GRCm39) missense unknown
Z1186:Hnrnpu UTSW 1 178,164,591 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GCCCTATCCTTGCCTGTATATGATAG -3'
(R):5'- TGGGTTCTCAACAGACTTGG -3'

Sequencing Primer
(F):5'- TACTGAATGCGTAAAACCAGGTC -3'
(R):5'- GCTAGAGTTCAAGGGGAT -3'
Posted On 2021-01-18