Incidental Mutation 'R8537:Olfr1111'
ID659272
Institutional Source Beutler Lab
Gene Symbol Olfr1111
Ensembl Gene ENSMUSG00000075158
Gene Nameolfactory receptor 1111
SynonymsMOR181-2, GA_x6K02T2Q125-48635468-48634530
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R8537 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87149181-87152624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87150038 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 208 (T208S)
Ref Sequence ENSEMBL: ENSMUSP00000150760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099860] [ENSMUST00000214492] [ENSMUST00000216378]
Predicted Effect probably benign
Transcript: ENSMUST00000099860
AA Change: T208S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000097446
Gene: ENSMUSG00000075158
AA Change: T208S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.2e-54 PFAM
Pfam:7tm_1 41 290 7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214492
AA Change: T208S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000216378
AA Change: T208S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,190,550 E579V probably damaging Het
Adgrv1 T A 13: 81,536,372 D1790V probably damaging Het
Avl9 T A 6: 56,728,659 Y175* probably null Het
Bmp2 A T 2: 133,561,282 D251V probably damaging Het
Camsap2 T A 1: 136,277,205 K1191N probably damaging Het
Ccdc102a A C 8: 94,906,056 F431C probably benign Het
Ccdc186 T C 19: 56,810,245 I270M probably damaging Het
Copb2 A G 9: 98,587,619 Q851R probably null Het
Cyp11b2 C T 15: 74,856,167 R22K probably benign Het
Ddx50 A G 10: 62,642,849 F186S probably damaging Het
Dhx38 T C 8: 109,553,380 Y926C probably damaging Het
Dmrt2 T C 19: 25,673,936 M162T possibly damaging Het
Dnah10 G T 5: 124,816,100 G3309V probably damaging Het
Dnajb2 T C 1: 75,239,598 F107S probably damaging Het
Dock8 T A 19: 25,130,506 S867T probably benign Het
Eif2ak1 C A 5: 143,899,069 T526K probably damaging Het
Gm30302 A G 13: 49,786,632 V534A possibly damaging Het
Gnas T C 2: 174,298,601 S188P possibly damaging Het
Gpam T C 19: 55,096,239 D36G probably benign Het
Gucy2e C A 11: 69,236,353 R98L probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpu T C 1: 178,333,634 probably benign Het
Icos A G 1: 60,993,942 D100G probably damaging Het
Ifi203 A T 1: 173,928,906 probably benign Het
Ift46 T A 9: 44,783,983 L92Q probably damaging Het
Kcnip2 C T 19: 45,815,730 probably null Het
Lgr5 T C 10: 115,452,402 Y779C probably damaging Het
Ltk G T 2: 119,758,107 P287Q probably benign Het
Mapk8ip3 A T 17: 24,901,678 C852* probably null Het
Mmp27 A G 9: 7,579,775 M443V probably benign Het
Muc6 T C 7: 141,647,917 D769G probably benign Het
Myo7b T C 18: 31,977,089 I1107V probably benign Het
Nebl T A 2: 17,350,709 H211L probably benign Het
Oaz3 T A 3: 94,436,435 K40N probably damaging Het
Olfr860 T A 9: 19,846,552 E22D probably damaging Het
Osbpl10 G T 9: 115,229,909 A718S probably benign Het
Ppp3ca T A 3: 136,797,858 I64K possibly damaging Het
Prlr T C 15: 10,314,180 probably benign Het
Rab3ip A G 10: 116,910,154 I424T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Sec62 G T 3: 30,818,812 R348L unknown Het
Sema5b C T 16: 35,651,609 A479V possibly damaging Het
Shank3 T C 15: 89,532,215 I222T probably damaging Het
Sp1 C T 15: 102,408,529 T154I possibly damaging Het
Srek1 A G 13: 103,752,449 probably benign Het
Tmem129 A G 5: 33,655,576 S143P possibly damaging Het
Tmem202 A T 9: 59,519,646 C194S probably benign Het
Tmprss15 A T 16: 79,087,515 I93K probably damaging Het
Ttn A G 2: 76,776,309 Y16340H probably damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Other mutations in Olfr1111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Olfr1111 APN 2 87149825 missense possibly damaging 0.53
IGL02217:Olfr1111 APN 2 87149887 missense probably benign 0.00
R0789:Olfr1111 UTSW 2 87149827 missense probably damaging 1.00
R1437:Olfr1111 UTSW 2 87149771 missense possibly damaging 0.94
R1696:Olfr1111 UTSW 2 87150380 missense probably benign 0.00
R1700:Olfr1111 UTSW 2 87149779 missense probably damaging 1.00
R1717:Olfr1111 UTSW 2 87149806 nonsense probably null
R4965:Olfr1111 UTSW 2 87150659 start codon destroyed possibly damaging 0.89
R5221:Olfr1111 UTSW 2 87150481 missense probably damaging 1.00
R5297:Olfr1111 UTSW 2 87150449 missense probably benign 0.01
R5837:Olfr1111 UTSW 2 87150355 missense probably benign 0.02
R6544:Olfr1111 UTSW 2 87149863 missense probably damaging 1.00
R6911:Olfr1111 UTSW 2 87149767 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAGCTAGTGGTGGGACGC -3'
(R):5'- TCTACATTGGTGTCTCGAAGG -3'

Sequencing Primer
(F):5'- GCAAGTACATAAACAGCAGTGTTC -3'
(R):5'- TCTCGAAGGGTCTGCTTCAGC -3'
Posted On2021-01-18