Incidental Mutation 'R8537:Avl9'
ID 659282
Institutional Source Beutler Lab
Gene Symbol Avl9
Ensembl Gene ENSMUSG00000029787
Gene Name AVL9 cell migration associated
Synonyms D730049P16Rik, 5830411G16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock # R8537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 56714899-56761912 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 56728659 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 175 (Y175*)
Ref Sequence ENSEMBL: ENSMUSP00000144696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031805] [ENSMUST00000177249] [ENSMUST00000204193]
AlphaFold Q80U56
Predicted Effect probably null
Transcript: ENSMUST00000031805
AA Change: Y175*
SMART Domains Protein: ENSMUSP00000031805
Gene: ENSMUSG00000029787
AA Change: Y175*

DomainStartEndE-ValueType
Pfam:Afi1 15 102 3.8e-11 PFAM
Pfam:Avl9 16 521 7.1e-160 PFAM
Pfam:DUF2347 19 175 1.6e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177249
AA Change: Y175*
SMART Domains Protein: ENSMUSP00000144696
Gene: ENSMUSG00000029787
AA Change: Y175*

DomainStartEndE-ValueType
Pfam:Afi1 15 111 2e-8 PFAM
Pfam:Avl9 16 209 3.9e-86 PFAM
Pfam:DUF2347 19 179 3.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204193
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,190,550 E579V probably damaging Het
Adgrv1 T A 13: 81,536,372 D1790V probably damaging Het
Bmp2 A T 2: 133,561,282 D251V probably damaging Het
Camsap2 T A 1: 136,277,205 K1191N probably damaging Het
Ccdc102a A C 8: 94,906,056 F431C probably benign Het
Ccdc186 T C 19: 56,810,245 I270M probably damaging Het
Copb2 A G 9: 98,587,619 Q851R probably null Het
Cyp11b2 C T 15: 74,856,167 R22K probably benign Het
Ddx50 A G 10: 62,642,849 F186S probably damaging Het
Dhx38 T C 8: 109,553,380 Y926C probably damaging Het
Dmrt2 T C 19: 25,673,936 M162T possibly damaging Het
Dnah10 G T 5: 124,816,100 G3309V probably damaging Het
Dnajb2 T C 1: 75,239,598 F107S probably damaging Het
Dock8 T A 19: 25,130,506 S867T probably benign Het
Eif2ak1 C A 5: 143,899,069 T526K probably damaging Het
Gm30302 A G 13: 49,786,632 V534A possibly damaging Het
Gnas T C 2: 174,298,601 S188P possibly damaging Het
Gpam T C 19: 55,096,239 D36G probably benign Het
Gucy2e C A 11: 69,236,353 R98L probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpu T C 1: 178,333,634 probably benign Het
Icos A G 1: 60,993,942 D100G probably damaging Het
Ifi203 A T 1: 173,928,906 probably benign Het
Ift46 T A 9: 44,783,983 L92Q probably damaging Het
Kcnip2 C T 19: 45,815,730 probably null Het
Lgr5 T C 10: 115,452,402 Y779C probably damaging Het
Ltk G T 2: 119,758,107 P287Q probably benign Het
Mapk8ip3 A T 17: 24,901,678 C852* probably null Het
Mmp27 A G 9: 7,579,775 M443V probably benign Het
Muc6 T C 7: 141,647,917 D769G probably benign Het
Myo7b T C 18: 31,977,089 I1107V probably benign Het
Nebl T A 2: 17,350,709 H211L probably benign Het
Oaz3 T A 3: 94,436,435 K40N probably damaging Het
Olfr1111 T A 2: 87,150,038 T208S probably benign Het
Olfr860 T A 9: 19,846,552 E22D probably damaging Het
Osbpl10 G T 9: 115,229,909 A718S probably benign Het
Ppp3ca T A 3: 136,797,858 I64K possibly damaging Het
Prlr T C 15: 10,314,180 probably benign Het
Rab3ip A G 10: 116,910,154 I424T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Sec62 G T 3: 30,818,812 R348L unknown Het
Sema5b C T 16: 35,651,609 A479V possibly damaging Het
Shank3 T C 15: 89,532,215 I222T probably damaging Het
Sp1 C T 15: 102,408,529 T154I possibly damaging Het
Srek1 A G 13: 103,752,449 probably benign Het
Tmem129 A G 5: 33,655,576 S143P possibly damaging Het
Tmem202 A T 9: 59,519,646 C194S probably benign Het
Tmprss15 A T 16: 79,087,515 I93K probably damaging Het
Ttn A G 2: 76,776,309 Y16340H probably damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Other mutations in Avl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Avl9 APN 6 56725090 missense probably damaging 1.00
IGL01433:Avl9 APN 6 56753397 missense probably damaging 0.99
IGL02865:Avl9 APN 6 56736873 missense probably damaging 1.00
IGL02932:Avl9 APN 6 56736551 missense probably benign 0.00
Athens UTSW 6 56753885 missense probably benign 0.00
Atlanta UTSW 6 56753390 missense possibly damaging 0.54
H8562:Avl9 UTSW 6 56757310 missense probably damaging 1.00
H8786:Avl9 UTSW 6 56757310 missense probably damaging 1.00
R0003:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0029:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0102:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0103:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0122:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0147:Avl9 UTSW 6 56736502 missense probably benign 0.00
R0372:Avl9 UTSW 6 56726324 critical splice donor site probably null
R0446:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0600:Avl9 UTSW 6 56736906 missense probably benign 0.03
R0667:Avl9 UTSW 6 56736483 missense probably benign 0.00
R1560:Avl9 UTSW 6 56725128 nonsense probably null
R1566:Avl9 UTSW 6 56736482 nonsense probably null
R2069:Avl9 UTSW 6 56736435 splice site probably benign
R2362:Avl9 UTSW 6 56736570 missense probably benign 0.07
R2483:Avl9 UTSW 6 56736843 missense probably benign
R2941:Avl9 UTSW 6 56753885 missense probably benign 0.00
R3028:Avl9 UTSW 6 56730687 unclassified probably benign
R3437:Avl9 UTSW 6 56736627 missense probably benign
R3690:Avl9 UTSW 6 56736827 missense probably benign
R3691:Avl9 UTSW 6 56736827 missense probably benign
R3947:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3948:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3949:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3972:Avl9 UTSW 6 56743408 missense probably damaging 1.00
R4734:Avl9 UTSW 6 56736494 missense probably damaging 0.96
R4739:Avl9 UTSW 6 56726309 missense probably damaging 1.00
R5661:Avl9 UTSW 6 56725102 nonsense probably null
R5664:Avl9 UTSW 6 56753839 missense probably damaging 1.00
R6010:Avl9 UTSW 6 56753390 missense possibly damaging 0.54
R6615:Avl9 UTSW 6 56753885 missense probably benign 0.00
R6719:Avl9 UTSW 6 56753385 missense probably damaging 1.00
R7138:Avl9 UTSW 6 56728257 missense probably damaging 1.00
R7947:Avl9 UTSW 6 56723541 missense possibly damaging 0.72
R8030:Avl9 UTSW 6 56741422 missense probably damaging 0.99
R8683:Avl9 UTSW 6 56753393 missense probably benign 0.14
R9098:Avl9 UTSW 6 56730643 missense probably benign 0.01
R9213:Avl9 UTSW 6 56743456 missense probably damaging 1.00
R9274:Avl9 UTSW 6 56743361 missense probably damaging 0.99
R9452:Avl9 UTSW 6 56729741 missense probably damaging 0.97
R9585:Avl9 UTSW 6 56757314 missense probably damaging 0.97
R9628:Avl9 UTSW 6 56736475 nonsense probably null
R9633:Avl9 UTSW 6 56730649 missense probably damaging 1.00
R9747:Avl9 UTSW 6 56753840 missense probably damaging 1.00
Z1176:Avl9 UTSW 6 56736764 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTCCATTTGCTCGGGC -3'
(R):5'- GCCTCTGCAATACATGTGAATATCATC -3'

Sequencing Primer
(F):5'- TCTTACAGAGGGCCCAAGCTTG -3'
(R):5'- ATGCTGAGTATTTAAGGAAGAAGC -3'
Posted On 2021-01-18