Incidental Mutation 'R8537:Dhx38'
ID659286
Institutional Source Beutler Lab
Gene Symbol Dhx38
Ensembl Gene ENSMUSG00000037993
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 38
Synonyms5730550P09Rik, Ddx38, Prp16
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R8537 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location109548011-109565861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109553380 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 926 (Y926C)
Ref Sequence ENSEMBL: ENSMUSP00000047865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042601]
Predicted Effect probably damaging
Transcript: ENSMUST00000042601
AA Change: Y926C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047865
Gene: ENSMUSG00000037993
AA Change: Y926C

DomainStartEndE-ValueType
Blast:DEXDc 3 146 2e-46 BLAST
low complexity region 147 204 N/A INTRINSIC
Blast:DEXDc 205 444 1e-105 BLAST
low complexity region 511 525 N/A INTRINSIC
DEXDc 531 715 6.88e-34 SMART
HELICc 759 862 1.11e-19 SMART
HA2 923 1013 3.22e-32 SMART
low complexity region 1163 1194 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD/H box family of splicing factors. This protein resembles yeast Prp16 more closely than other DEAD/H family members. It is an ATPase and essential for the catalytic step II in pre-mRNA splicing process. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,190,550 E579V probably damaging Het
Adgrv1 T A 13: 81,536,372 D1790V probably damaging Het
Avl9 T A 6: 56,728,659 Y175* probably null Het
Bmp2 A T 2: 133,561,282 D251V probably damaging Het
Camsap2 T A 1: 136,277,205 K1191N probably damaging Het
Ccdc102a A C 8: 94,906,056 F431C probably benign Het
Ccdc186 T C 19: 56,810,245 I270M probably damaging Het
Copb2 A G 9: 98,587,619 Q851R probably null Het
Cyp11b2 C T 15: 74,856,167 R22K probably benign Het
Ddx50 A G 10: 62,642,849 F186S probably damaging Het
Dmrt2 T C 19: 25,673,936 M162T possibly damaging Het
Dnah10 G T 5: 124,816,100 G3309V probably damaging Het
Dnajb2 T C 1: 75,239,598 F107S probably damaging Het
Dock8 T A 19: 25,130,506 S867T probably benign Het
Eif2ak1 C A 5: 143,899,069 T526K probably damaging Het
Gm30302 A G 13: 49,786,632 V534A possibly damaging Het
Gnas T C 2: 174,298,601 S188P possibly damaging Het
Gpam T C 19: 55,096,239 D36G probably benign Het
Gucy2e C A 11: 69,236,353 R98L probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpu T C 1: 178,333,634 probably benign Het
Icos A G 1: 60,993,942 D100G probably damaging Het
Ifi203 A T 1: 173,928,906 probably benign Het
Ift46 T A 9: 44,783,983 L92Q probably damaging Het
Kcnip2 C T 19: 45,815,730 probably null Het
Lgr5 T C 10: 115,452,402 Y779C probably damaging Het
Ltk G T 2: 119,758,107 P287Q probably benign Het
Mapk8ip3 A T 17: 24,901,678 C852* probably null Het
Mmp27 A G 9: 7,579,775 M443V probably benign Het
Muc6 T C 7: 141,647,917 D769G probably benign Het
Myo7b T C 18: 31,977,089 I1107V probably benign Het
Nebl T A 2: 17,350,709 H211L probably benign Het
Oaz3 T A 3: 94,436,435 K40N probably damaging Het
Olfr1111 T A 2: 87,150,038 T208S probably benign Het
Olfr860 T A 9: 19,846,552 E22D probably damaging Het
Osbpl10 G T 9: 115,229,909 A718S probably benign Het
Ppp3ca T A 3: 136,797,858 I64K possibly damaging Het
Prlr T C 15: 10,314,180 probably benign Het
Rab3ip A G 10: 116,910,154 I424T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Sec62 G T 3: 30,818,812 R348L unknown Het
Sema5b C T 16: 35,651,609 A479V possibly damaging Het
Shank3 T C 15: 89,532,215 I222T probably damaging Het
Sp1 C T 15: 102,408,529 T154I possibly damaging Het
Srek1 A G 13: 103,752,449 probably benign Het
Tmem129 A G 5: 33,655,576 S143P possibly damaging Het
Tmem202 A T 9: 59,519,646 C194S probably benign Het
Tmprss15 A T 16: 79,087,515 I93K probably damaging Het
Ttn A G 2: 76,776,309 Y16340H probably damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Other mutations in Dhx38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Dhx38 APN 8 109556934 missense possibly damaging 0.49
IGL00821:Dhx38 APN 8 109555654 missense probably benign 0.00
IGL00910:Dhx38 APN 8 109559034 missense probably benign 0.07
IGL01011:Dhx38 APN 8 109562691 missense probably benign
IGL01401:Dhx38 APN 8 109552114 missense probably benign 0.15
IGL02133:Dhx38 APN 8 109558241 nonsense probably null
IGL02529:Dhx38 APN 8 109559013 missense probably benign 0.00
IGL02652:Dhx38 APN 8 109556129 missense probably damaging 1.00
IGL03241:Dhx38 APN 8 109562656 missense possibly damaging 0.47
IGL03378:Dhx38 APN 8 109559090 splice site probably null
R0358:Dhx38 UTSW 8 109552462 missense probably benign 0.13
R0375:Dhx38 UTSW 8 109555181 missense possibly damaging 0.89
R0437:Dhx38 UTSW 8 109558629 splice site probably benign
R0481:Dhx38 UTSW 8 109556216 splice site probably benign
R0492:Dhx38 UTSW 8 109561944 splice site probably benign
R0528:Dhx38 UTSW 8 109562661 missense probably benign 0.00
R0607:Dhx38 UTSW 8 109558943 missense probably benign 0.07
R1638:Dhx38 UTSW 8 109553545 missense probably damaging 1.00
R2020:Dhx38 UTSW 8 109556869 splice site probably benign
R2056:Dhx38 UTSW 8 109562720 unclassified probably benign
R2096:Dhx38 UTSW 8 109554259 missense probably damaging 1.00
R2152:Dhx38 UTSW 8 109560674 missense probably benign 0.00
R2154:Dhx38 UTSW 8 109560674 missense probably benign 0.00
R2382:Dhx38 UTSW 8 109556140 missense probably damaging 0.99
R4367:Dhx38 UTSW 8 109553131 missense probably damaging 1.00
R4368:Dhx38 UTSW 8 109553131 missense probably damaging 1.00
R4369:Dhx38 UTSW 8 109553131 missense probably damaging 1.00
R5250:Dhx38 UTSW 8 109556520 missense probably damaging 1.00
R5354:Dhx38 UTSW 8 109555746 missense probably damaging 1.00
R5668:Dhx38 UTSW 8 109553416 missense probably damaging 1.00
R5777:Dhx38 UTSW 8 109556902 missense possibly damaging 0.81
R5784:Dhx38 UTSW 8 109559613 nonsense probably null
R6799:Dhx38 UTSW 8 109553202 missense probably damaging 1.00
R6915:Dhx38 UTSW 8 109559599 missense probably benign 0.15
R6932:Dhx38 UTSW 8 109552675 missense probably damaging 1.00
R7042:Dhx38 UTSW 8 109556985 missense possibly damaging 0.55
R7248:Dhx38 UTSW 8 109558927 missense probably benign 0.15
R7394:Dhx38 UTSW 8 109556523 missense probably damaging 1.00
R7513:Dhx38 UTSW 8 109560589 missense probably benign 0.00
R7569:Dhx38 UTSW 8 109560695 missense probably damaging 0.98
R8003:Dhx38 UTSW 8 109556140 missense probably damaging 0.99
R8071:Dhx38 UTSW 8 109558701 missense probably benign 0.10
R8852:Dhx38 UTSW 8 109562729 nonsense probably null
R8860:Dhx38 UTSW 8 109562729 nonsense probably null
R8937:Dhx38 UTSW 8 109556466 missense probably damaging 0.96
Z1177:Dhx38 UTSW 8 109556085 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGAGCATCTTAGAGAGGGCC -3'
(R):5'- GTAGCTAACACGTGAGAGGCTG -3'

Sequencing Primer
(F):5'- ATCTTAGAGAGGGCCGGGTC -3'
(R):5'- TCCCTGGCAGGCTCTACAC -3'
Posted On2021-01-18