Incidental Mutation 'R8537:Mmp27'
ID 659287
Institutional Source Beutler Lab
Gene Symbol Mmp27
Ensembl Gene ENSMUSG00000070323
Gene Name matrix metallopeptidase 27
Synonyms LOC234911
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 7571396-7581885 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7579775 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 443 (M443V)
Ref Sequence ENSEMBL: ENSMUSP00000117469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120900] [ENSMUST00000151853]
AlphaFold D3YV89
Predicted Effect probably benign
Transcript: ENSMUST00000120900
AA Change: M417V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113231
Gene: ENSMUSG00000070323
AA Change: M417V

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1e-13 PFAM
ZnMc 116 277 1.76e-50 SMART
HX 300 342 5.97e-4 SMART
HX 344 386 1.1e-7 SMART
HX 391 438 1.09e-6 SMART
HX 440 480 3.2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151853
AA Change: M443V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000117469
Gene: ENSMUSG00000070323
AA Change: M443V

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.1e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116263
Gene: ENSMUSG00000070323
AA Change: M361V

DomainStartEndE-ValueType
Pfam:PG_binding_1 39 99 1.1e-13 PFAM
ZnMc 115 295 1.41e-13 SMART
HX 245 287 5.97e-4 SMART
HX 289 331 1.1e-7 SMART
HX 336 383 1.09e-6 SMART
HX 385 425 3.2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,190,550 E579V probably damaging Het
Adgrv1 T A 13: 81,536,372 D1790V probably damaging Het
Avl9 T A 6: 56,728,659 Y175* probably null Het
Bmp2 A T 2: 133,561,282 D251V probably damaging Het
Camsap2 T A 1: 136,277,205 K1191N probably damaging Het
Ccdc102a A C 8: 94,906,056 F431C probably benign Het
Ccdc186 T C 19: 56,810,245 I270M probably damaging Het
Copb2 A G 9: 98,587,619 Q851R probably null Het
Cyp11b2 C T 15: 74,856,167 R22K probably benign Het
Ddx50 A G 10: 62,642,849 F186S probably damaging Het
Dhx38 T C 8: 109,553,380 Y926C probably damaging Het
Dmrt2 T C 19: 25,673,936 M162T possibly damaging Het
Dnah10 G T 5: 124,816,100 G3309V probably damaging Het
Dnajb2 T C 1: 75,239,598 F107S probably damaging Het
Dock8 T A 19: 25,130,506 S867T probably benign Het
Eif2ak1 C A 5: 143,899,069 T526K probably damaging Het
Gm30302 A G 13: 49,786,632 V534A possibly damaging Het
Gnas T C 2: 174,298,601 S188P possibly damaging Het
Gpam T C 19: 55,096,239 D36G probably benign Het
Gucy2e C A 11: 69,236,353 R98L probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpu T C 1: 178,333,634 probably benign Het
Icos A G 1: 60,993,942 D100G probably damaging Het
Ifi203 A T 1: 173,928,906 probably benign Het
Ift46 T A 9: 44,783,983 L92Q probably damaging Het
Kcnip2 C T 19: 45,815,730 probably null Het
Lgr5 T C 10: 115,452,402 Y779C probably damaging Het
Ltk G T 2: 119,758,107 P287Q probably benign Het
Mapk8ip3 A T 17: 24,901,678 C852* probably null Het
Muc6 T C 7: 141,647,917 D769G probably benign Het
Myo7b T C 18: 31,977,089 I1107V probably benign Het
Nebl T A 2: 17,350,709 H211L probably benign Het
Oaz3 T A 3: 94,436,435 K40N probably damaging Het
Olfr1111 T A 2: 87,150,038 T208S probably benign Het
Olfr860 T A 9: 19,846,552 E22D probably damaging Het
Osbpl10 G T 9: 115,229,909 A718S probably benign Het
Ppp3ca T A 3: 136,797,858 I64K possibly damaging Het
Prlr T C 15: 10,314,180 probably benign Het
Rab3ip A G 10: 116,910,154 I424T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Sec62 G T 3: 30,818,812 R348L unknown Het
Sema5b C T 16: 35,651,609 A479V possibly damaging Het
Shank3 T C 15: 89,532,215 I222T probably damaging Het
Sp1 C T 15: 102,408,529 T154I possibly damaging Het
Srek1 A G 13: 103,752,449 probably benign Het
Tmem129 A G 5: 33,655,576 S143P possibly damaging Het
Tmem202 A T 9: 59,519,646 C194S probably benign Het
Tmprss15 A T 16: 79,087,515 I93K probably damaging Het
Ttn A G 2: 76,776,309 Y16340H probably damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Other mutations in Mmp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Mmp27 APN 9 7573504 splice site probably benign
IGL00656:Mmp27 APN 9 7581382 missense possibly damaging 0.80
IGL00937:Mmp27 APN 9 7578899 critical splice acceptor site probably benign 0.00
IGL01101:Mmp27 APN 9 7573415 missense probably damaging 1.00
IGL01134:Mmp27 APN 9 7573297 missense probably benign 0.06
IGL01631:Mmp27 APN 9 7573288 critical splice acceptor site probably benign 0.00
IGL02967:Mmp27 APN 9 7571590 missense probably benign 0.03
IGL03024:Mmp27 APN 9 7581376 missense probably benign 0.17
R0662:Mmp27 UTSW 9 7577650 missense probably benign 0.00
R0715:Mmp27 UTSW 9 7581155 splice site probably benign
R0826:Mmp27 UTSW 9 7579009 missense probably damaging 1.00
R1191:Mmp27 UTSW 9 7579066 splice site probably null
R1793:Mmp27 UTSW 9 7571458 start codon destroyed probably null 0.00
R1983:Mmp27 UTSW 9 7578897 splice site probably null
R2074:Mmp27 UTSW 9 7577739 missense possibly damaging 0.50
R2172:Mmp27 UTSW 9 7577378 nonsense probably null
R2445:Mmp27 UTSW 9 7581181 missense probably benign 0.12
R2961:Mmp27 UTSW 9 7573602 missense probably damaging 1.00
R4825:Mmp27 UTSW 9 7581194 missense probably damaging 1.00
R4888:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R4938:Mmp27 UTSW 9 7578982 missense probably damaging 0.97
R5095:Mmp27 UTSW 9 7572158 missense probably damaging 1.00
R5095:Mmp27 UTSW 9 7579000 missense probably damaging 1.00
R5121:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R5446:Mmp27 UTSW 9 7573515 splice site probably benign
R5485:Mmp27 UTSW 9 7573362 missense probably damaging 1.00
R5516:Mmp27 UTSW 9 7579062 missense probably null 1.00
R6682:Mmp27 UTSW 9 7573605 missense probably benign 0.02
R6712:Mmp27 UTSW 9 7572176 missense probably damaging 1.00
R6737:Mmp27 UTSW 9 7571954 missense possibly damaging 0.78
R7282:Mmp27 UTSW 9 7578230 missense probably damaging 0.98
R7368:Mmp27 UTSW 9 7577317 missense probably damaging 1.00
R7689:Mmp27 UTSW 9 7579001 missense probably damaging 1.00
R8006:Mmp27 UTSW 9 7578984 missense probably damaging 0.97
R8185:Mmp27 UTSW 9 7573491 missense unknown
R9039:Mmp27 UTSW 9 7581249 missense probably benign 0.01
R9087:Mmp27 UTSW 9 7579857 missense probably damaging 1.00
R9188:Mmp27 UTSW 9 7579791 missense possibly damaging 0.55
R9280:Mmp27 UTSW 9 7579811 missense probably benign 0.09
R9367:Mmp27 UTSW 9 7573549 missense probably damaging 1.00
X0021:Mmp27 UTSW 9 7573298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAGTTTGGTACGGTGGC -3'
(R):5'- CACTAAAATTGAACGTTTGCCC -3'

Sequencing Primer
(F):5'- TACGGTGGCATCTGAGCATAC -3'
(R):5'- AAATTGAACGTTTGCCCTTTGTGC -3'
Posted On 2021-01-18