Incidental Mutation 'R8537:Rab3ip'
ID 659295
Institutional Source Beutler Lab
Gene Symbol Rab3ip
Ensembl Gene ENSMUSG00000064181
Gene Name RAB3A interacting protein
Synonyms Rabin3, Gtpat12, SSX2 interacting protein
MMRRC Submission 067891-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 116741685-116786361 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116746059 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 424 (I424T)
Ref Sequence ENSEMBL: ENSMUSP00000151708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020375] [ENSMUST00000219109]
AlphaFold Q68EF0
Predicted Effect probably damaging
Transcript: ENSMUST00000020375
AA Change: I392T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020375
Gene: ENSMUSG00000064181
AA Change: I392T

DomainStartEndE-ValueType
low complexity region 84 100 N/A INTRINSIC
PDB:4LHZ|F 157 200 9e-15 PDB
low complexity region 213 220 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219109
AA Change: I424T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are fertile and show no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,684,491 (GRCm39) D1790V probably damaging Het
Aopep A T 13: 63,338,364 (GRCm39) E579V probably damaging Het
Avl9 T A 6: 56,705,644 (GRCm39) Y175* probably null Het
Bmp2 A T 2: 133,403,202 (GRCm39) D251V probably damaging Het
Camsap2 T A 1: 136,204,943 (GRCm39) K1191N probably damaging Het
Ccdc102a A C 8: 95,632,684 (GRCm39) F431C probably benign Het
Ccdc186 T C 19: 56,798,677 (GRCm39) I270M probably damaging Het
Copb2 A G 9: 98,469,672 (GRCm39) Q851R probably null Het
Cyp11b2 C T 15: 74,728,016 (GRCm39) R22K probably benign Het
Ddx50 A G 10: 62,478,628 (GRCm39) F186S probably damaging Het
Dhx38 T C 8: 110,280,012 (GRCm39) Y926C probably damaging Het
Dmrt2 T C 19: 25,651,300 (GRCm39) M162T possibly damaging Het
Dnah10 G T 5: 124,893,164 (GRCm39) G3309V probably damaging Het
Dnajb2 T C 1: 75,216,242 (GRCm39) F107S probably damaging Het
Dock8 T A 19: 25,107,870 (GRCm39) S867T probably benign Het
Eif2ak1 C A 5: 143,835,887 (GRCm39) T526K probably damaging Het
Gnas T C 2: 174,140,394 (GRCm39) S188P possibly damaging Het
Gpam T C 19: 55,084,671 (GRCm39) D36G probably benign Het
Gucy2e C A 11: 69,127,179 (GRCm39) R98L probably benign Het
Hmcn2 C A 2: 31,281,088 (GRCm39) L1867I probably benign Het
Hnrnpu T C 1: 178,161,199 (GRCm39) probably benign Het
Icos A G 1: 61,033,101 (GRCm39) D100G probably damaging Het
Ifi203 A T 1: 173,756,472 (GRCm39) probably benign Het
Ift46 T A 9: 44,695,280 (GRCm39) L92Q probably damaging Het
Kcnip2 C T 19: 45,804,169 (GRCm39) probably null Het
Lgr5 T C 10: 115,288,307 (GRCm39) Y779C probably damaging Het
Ltk G T 2: 119,588,588 (GRCm39) P287Q probably benign Het
Mapk8ip3 A T 17: 25,120,652 (GRCm39) C852* probably null Het
Mmp27 A G 9: 7,579,776 (GRCm39) M443V probably benign Het
Muc6 T C 7: 141,234,184 (GRCm39) D769G probably benign Het
Myo7b T C 18: 32,110,142 (GRCm39) I1107V probably benign Het
Nebl T A 2: 17,355,520 (GRCm39) H211L probably benign Het
Oaz3 T A 3: 94,343,742 (GRCm39) K40N probably damaging Het
Or5as1 T A 2: 86,980,382 (GRCm39) T208S probably benign Het
Or7e169 T A 9: 19,757,848 (GRCm39) E22D probably damaging Het
Osbpl10 G T 9: 115,058,977 (GRCm39) A718S probably benign Het
Ppp3ca T A 3: 136,503,619 (GRCm39) I64K possibly damaging Het
Prlr T C 15: 10,314,266 (GRCm39) probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,121 (GRCm39) probably benign Het
Sec62 G T 3: 30,872,961 (GRCm39) R348L unknown Het
Sema5b C T 16: 35,471,979 (GRCm39) A479V possibly damaging Het
Shank3 T C 15: 89,416,418 (GRCm39) I222T probably damaging Het
Sp1 C T 15: 102,316,964 (GRCm39) T154I possibly damaging Het
Spata31e1 A G 13: 49,940,108 (GRCm39) V534A possibly damaging Het
Srek1 A G 13: 103,888,957 (GRCm39) probably benign Het
Tmem129 A G 5: 33,812,920 (GRCm39) S143P possibly damaging Het
Tmem202 A T 9: 59,426,929 (GRCm39) C194S probably benign Het
Tmprss15 A T 16: 78,884,403 (GRCm39) I93K probably damaging Het
Ttn A G 2: 76,606,653 (GRCm39) Y16340H probably damaging Het
Uck1 C A 2: 32,150,153 (GRCm39) probably benign Het
Other mutations in Rab3ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Rab3ip APN 10 116,742,997 (GRCm39) missense probably benign 0.09
IGL01946:Rab3ip APN 10 116,773,300 (GRCm39) critical splice donor site probably null
IGL02665:Rab3ip APN 10 116,773,453 (GRCm39) missense probably benign 0.02
R1538:Rab3ip UTSW 10 116,775,159 (GRCm39) missense probably damaging 1.00
R1565:Rab3ip UTSW 10 116,775,128 (GRCm39) missense probably benign 0.09
R1760:Rab3ip UTSW 10 116,773,415 (GRCm39) missense probably damaging 1.00
R2077:Rab3ip UTSW 10 116,754,865 (GRCm39) missense possibly damaging 0.87
R4441:Rab3ip UTSW 10 116,751,837 (GRCm39) missense probably benign 0.19
R5442:Rab3ip UTSW 10 116,754,753 (GRCm39) missense probably benign
R5526:Rab3ip UTSW 10 116,754,834 (GRCm39) missense possibly damaging 0.61
R5682:Rab3ip UTSW 10 116,743,008 (GRCm39) nonsense probably null
R5921:Rab3ip UTSW 10 116,775,152 (GRCm39) missense probably damaging 1.00
R6254:Rab3ip UTSW 10 116,751,772 (GRCm39) missense probably damaging 1.00
R7021:Rab3ip UTSW 10 116,775,283 (GRCm39) missense probably damaging 1.00
R7026:Rab3ip UTSW 10 116,773,441 (GRCm39) missense probably benign 0.18
R7326:Rab3ip UTSW 10 116,773,538 (GRCm39) missense probably benign 0.07
R7408:Rab3ip UTSW 10 116,773,546 (GRCm39) missense possibly damaging 0.62
R7655:Rab3ip UTSW 10 116,750,044 (GRCm39) missense probably benign 0.04
R7656:Rab3ip UTSW 10 116,750,044 (GRCm39) missense probably benign 0.04
R8363:Rab3ip UTSW 10 116,754,869 (GRCm39) missense probably damaging 1.00
R9085:Rab3ip UTSW 10 116,775,310 (GRCm39) missense probably damaging 1.00
R9086:Rab3ip UTSW 10 116,775,310 (GRCm39) missense probably damaging 1.00
R9161:Rab3ip UTSW 10 116,750,066 (GRCm39) missense probably damaging 1.00
R9451:Rab3ip UTSW 10 116,775,354 (GRCm39) start codon destroyed probably null 0.97
R9563:Rab3ip UTSW 10 116,754,668 (GRCm39) missense probably null 1.00
R9564:Rab3ip UTSW 10 116,751,780 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGAACTGGTTCTACTCAAACC -3'
(R):5'- GGACTCCAGCTGCTGTTACTAC -3'

Sequencing Primer
(F):5'- TGGTTCTACTCAAACCTCAAGAG -3'
(R):5'- ACATCTCTCCTTTCTGCAGATACAGG -3'
Posted On 2021-01-18