Incidental Mutation 'R8537:Gm30302'
ID 659297
Institutional Source Beutler Lab
Gene Symbol Gm30302
Ensembl Gene ENSMUSG00000114073
Gene Name predicted gene, 30302
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock # R8537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 49784765-49799001 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49786632 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 534 (V534A)
Ref Sequence ENSEMBL: ENSMUSP00000152227 (fasta)
AlphaFold A0A1Y7VN40
Predicted Effect possibly damaging
Transcript: ENSMUST00000220773
AA Change: V534A

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000223497
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,190,550 E579V probably damaging Het
Adgrv1 T A 13: 81,536,372 D1790V probably damaging Het
Avl9 T A 6: 56,728,659 Y175* probably null Het
Bmp2 A T 2: 133,561,282 D251V probably damaging Het
Camsap2 T A 1: 136,277,205 K1191N probably damaging Het
Ccdc102a A C 8: 94,906,056 F431C probably benign Het
Ccdc186 T C 19: 56,810,245 I270M probably damaging Het
Copb2 A G 9: 98,587,619 Q851R probably null Het
Cyp11b2 C T 15: 74,856,167 R22K probably benign Het
Ddx50 A G 10: 62,642,849 F186S probably damaging Het
Dhx38 T C 8: 109,553,380 Y926C probably damaging Het
Dmrt2 T C 19: 25,673,936 M162T possibly damaging Het
Dnah10 G T 5: 124,816,100 G3309V probably damaging Het
Dnajb2 T C 1: 75,239,598 F107S probably damaging Het
Dock8 T A 19: 25,130,506 S867T probably benign Het
Eif2ak1 C A 5: 143,899,069 T526K probably damaging Het
Gnas T C 2: 174,298,601 S188P possibly damaging Het
Gpam T C 19: 55,096,239 D36G probably benign Het
Gucy2e C A 11: 69,236,353 R98L probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpu T C 1: 178,333,634 probably benign Het
Icos A G 1: 60,993,942 D100G probably damaging Het
Ifi203 A T 1: 173,928,906 probably benign Het
Ift46 T A 9: 44,783,983 L92Q probably damaging Het
Kcnip2 C T 19: 45,815,730 probably null Het
Lgr5 T C 10: 115,452,402 Y779C probably damaging Het
Ltk G T 2: 119,758,107 P287Q probably benign Het
Mapk8ip3 A T 17: 24,901,678 C852* probably null Het
Mmp27 A G 9: 7,579,775 M443V probably benign Het
Muc6 T C 7: 141,647,917 D769G probably benign Het
Myo7b T C 18: 31,977,089 I1107V probably benign Het
Nebl T A 2: 17,350,709 H211L probably benign Het
Oaz3 T A 3: 94,436,435 K40N probably damaging Het
Olfr1111 T A 2: 87,150,038 T208S probably benign Het
Olfr860 T A 9: 19,846,552 E22D probably damaging Het
Osbpl10 G T 9: 115,229,909 A718S probably benign Het
Ppp3ca T A 3: 136,797,858 I64K possibly damaging Het
Prlr T C 15: 10,314,180 probably benign Het
Rab3ip A G 10: 116,910,154 I424T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Sec62 G T 3: 30,818,812 R348L unknown Het
Sema5b C T 16: 35,651,609 A479V possibly damaging Het
Shank3 T C 15: 89,532,215 I222T probably damaging Het
Sp1 C T 15: 102,408,529 T154I possibly damaging Het
Srek1 A G 13: 103,752,449 probably benign Het
Tmem129 A G 5: 33,655,576 S143P possibly damaging Het
Tmem202 A T 9: 59,519,646 C194S probably benign Het
Tmprss15 A T 16: 79,087,515 I93K probably damaging Het
Ttn A G 2: 76,776,309 Y16340H probably damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Other mutations in Gm30302
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6813:Gm30302 UTSW 13 49787396 missense probably benign 0.03
R7638:Gm30302 UTSW 13 49786975 missense probably benign 0.02
R7881:Gm30302 UTSW 13 49790071 missense possibly damaging 0.83
R8097:Gm30302 UTSW 13 49790200 start codon destroyed probably benign 0.02
R8113:Gm30302 UTSW 13 49786072 missense probably benign 0.18
R8414:Gm30302 UTSW 13 49787797 missense probably damaging 1.00
R8787:Gm30302 UTSW 13 49785228 missense probably damaging 0.97
R8864:Gm30302 UTSW 13 49787512 missense probably benign 0.18
R8973:Gm30302 UTSW 13 49788239 missense probably benign 0.00
R8974:Gm30302 UTSW 13 49786080 missense probably benign 0.00
R9060:Gm30302 UTSW 13 49786611 missense probably damaging 0.97
R9162:Gm30302 UTSW 13 49785834 missense possibly damaging 0.66
R9371:Gm30302 UTSW 13 49785576 missense unknown
R9399:Gm30302 UTSW 13 49786699 missense possibly damaging 0.89
R9778:Gm30302 UTSW 13 49786066 missense possibly damaging 0.59
R9782:Gm30302 UTSW 13 49786066 missense possibly damaging 0.59
Z1176:Gm30302 UTSW 13 49785384 missense possibly damaging 0.90
Z1176:Gm30302 UTSW 13 49786462 missense possibly damaging 0.79
Z1176:Gm30302 UTSW 13 49787848 missense probably damaging 1.00
Z1177:Gm30302 UTSW 13 49787175 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGCCCAGCAATTCTTGAGC -3'
(R):5'- GTCATCCAATCTGGGGTTCC -3'

Sequencing Primer
(F):5'- CCAGCAATTCTTGAGCTAGTTCTTGG -3'
(R):5'- GTTCCAACCTCATACCTTCCCCAG -3'
Posted On 2021-01-18