Incidental Mutation 'R8537:Srek1'
ID 659300
Institutional Source Beutler Lab
Gene Symbol Srek1
Ensembl Gene ENSMUSG00000032621
Gene Name splicing regulatory glutamine/lysine-rich protein 1
Synonyms SRrp86, Sfrs12, AL118220, SRrp508
MMRRC Submission 067891-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.950) question?
Stock # R8537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 103875856-103911116 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 103888957 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074616] [ENSMUST00000210489] [ENSMUST00000210836] [ENSMUST00000211322]
AlphaFold Q8BZX4
Predicted Effect unknown
Transcript: ENSMUST00000074616
AA Change: S462P
SMART Domains Protein: ENSMUSP00000074196
Gene: ENSMUSG00000032621
AA Change: S462P

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
RRM 70 141 1.22e-18 SMART
coiled coil region 259 298 N/A INTRINSIC
low complexity region 356 395 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 414 427 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000210489
AA Change: S346P
Predicted Effect probably benign
Transcript: ENSMUST00000210836
Predicted Effect probably benign
Transcript: ENSMUST00000211322
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of serine/arginine-rich (SR) splicing proteins containing RNA recognition motif (RRM) domains. The encoded protein interacts with other SR proteins to modulate splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,684,491 (GRCm39) D1790V probably damaging Het
Aopep A T 13: 63,338,364 (GRCm39) E579V probably damaging Het
Avl9 T A 6: 56,705,644 (GRCm39) Y175* probably null Het
Bmp2 A T 2: 133,403,202 (GRCm39) D251V probably damaging Het
Camsap2 T A 1: 136,204,943 (GRCm39) K1191N probably damaging Het
Ccdc102a A C 8: 95,632,684 (GRCm39) F431C probably benign Het
Ccdc186 T C 19: 56,798,677 (GRCm39) I270M probably damaging Het
Copb2 A G 9: 98,469,672 (GRCm39) Q851R probably null Het
Cyp11b2 C T 15: 74,728,016 (GRCm39) R22K probably benign Het
Ddx50 A G 10: 62,478,628 (GRCm39) F186S probably damaging Het
Dhx38 T C 8: 110,280,012 (GRCm39) Y926C probably damaging Het
Dmrt2 T C 19: 25,651,300 (GRCm39) M162T possibly damaging Het
Dnah10 G T 5: 124,893,164 (GRCm39) G3309V probably damaging Het
Dnajb2 T C 1: 75,216,242 (GRCm39) F107S probably damaging Het
Dock8 T A 19: 25,107,870 (GRCm39) S867T probably benign Het
Eif2ak1 C A 5: 143,835,887 (GRCm39) T526K probably damaging Het
Gnas T C 2: 174,140,394 (GRCm39) S188P possibly damaging Het
Gpam T C 19: 55,084,671 (GRCm39) D36G probably benign Het
Gucy2e C A 11: 69,127,179 (GRCm39) R98L probably benign Het
Hmcn2 C A 2: 31,281,088 (GRCm39) L1867I probably benign Het
Hnrnpu T C 1: 178,161,199 (GRCm39) probably benign Het
Icos A G 1: 61,033,101 (GRCm39) D100G probably damaging Het
Ifi203 A T 1: 173,756,472 (GRCm39) probably benign Het
Ift46 T A 9: 44,695,280 (GRCm39) L92Q probably damaging Het
Kcnip2 C T 19: 45,804,169 (GRCm39) probably null Het
Lgr5 T C 10: 115,288,307 (GRCm39) Y779C probably damaging Het
Ltk G T 2: 119,588,588 (GRCm39) P287Q probably benign Het
Mapk8ip3 A T 17: 25,120,652 (GRCm39) C852* probably null Het
Mmp27 A G 9: 7,579,776 (GRCm39) M443V probably benign Het
Muc6 T C 7: 141,234,184 (GRCm39) D769G probably benign Het
Myo7b T C 18: 32,110,142 (GRCm39) I1107V probably benign Het
Nebl T A 2: 17,355,520 (GRCm39) H211L probably benign Het
Oaz3 T A 3: 94,343,742 (GRCm39) K40N probably damaging Het
Or5as1 T A 2: 86,980,382 (GRCm39) T208S probably benign Het
Or7e169 T A 9: 19,757,848 (GRCm39) E22D probably damaging Het
Osbpl10 G T 9: 115,058,977 (GRCm39) A718S probably benign Het
Ppp3ca T A 3: 136,503,619 (GRCm39) I64K possibly damaging Het
Prlr T C 15: 10,314,266 (GRCm39) probably benign Het
Rab3ip A G 10: 116,746,059 (GRCm39) I424T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,121 (GRCm39) probably benign Het
Sec62 G T 3: 30,872,961 (GRCm39) R348L unknown Het
Sema5b C T 16: 35,471,979 (GRCm39) A479V possibly damaging Het
Shank3 T C 15: 89,416,418 (GRCm39) I222T probably damaging Het
Sp1 C T 15: 102,316,964 (GRCm39) T154I possibly damaging Het
Spata31e1 A G 13: 49,940,108 (GRCm39) V534A possibly damaging Het
Tmem129 A G 5: 33,812,920 (GRCm39) S143P possibly damaging Het
Tmem202 A T 9: 59,426,929 (GRCm39) C194S probably benign Het
Tmprss15 A T 16: 78,884,403 (GRCm39) I93K probably damaging Het
Ttn A G 2: 76,606,653 (GRCm39) Y16340H probably damaging Het
Uck1 C A 2: 32,150,153 (GRCm39) probably benign Het
Other mutations in Srek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Srek1 APN 13 103,897,090 (GRCm39) missense probably damaging 1.00
IGL01834:Srek1 APN 13 103,885,293 (GRCm39) unclassified probably benign
IGL03029:Srek1 APN 13 103,900,468 (GRCm39) utr 5 prime probably benign
IGL03198:Srek1 APN 13 103,881,443 (GRCm39) splice site probably null
IGL03284:Srek1 APN 13 103,897,045 (GRCm39) missense probably damaging 0.96
inscruitable UTSW 13 103,910,894 (GRCm39) missense probably damaging 1.00
PIT4453001:Srek1 UTSW 13 103,881,291 (GRCm39) critical splice donor site probably null
R0080:Srek1 UTSW 13 103,880,194 (GRCm39) missense unknown
R0082:Srek1 UTSW 13 103,880,194 (GRCm39) missense unknown
R0106:Srek1 UTSW 13 103,880,131 (GRCm39) missense unknown
R0106:Srek1 UTSW 13 103,880,131 (GRCm39) missense unknown
R0506:Srek1 UTSW 13 103,897,098 (GRCm39) missense probably damaging 0.99
R0569:Srek1 UTSW 13 103,885,370 (GRCm39) unclassified probably benign
R0969:Srek1 UTSW 13 103,889,011 (GRCm39) unclassified probably benign
R1617:Srek1 UTSW 13 103,880,112 (GRCm39) missense unknown
R2098:Srek1 UTSW 13 103,881,363 (GRCm39) missense unknown
R2423:Srek1 UTSW 13 103,889,536 (GRCm39) nonsense probably null
R3950:Srek1 UTSW 13 103,881,403 (GRCm39) missense unknown
R4347:Srek1 UTSW 13 103,885,267 (GRCm39) missense probably null
R4676:Srek1 UTSW 13 103,894,695 (GRCm39) splice site probably benign
R4915:Srek1 UTSW 13 103,889,194 (GRCm39) utr 3 prime probably benign
R4915:Srek1 UTSW 13 103,889,071 (GRCm39) unclassified probably benign
R5119:Srek1 UTSW 13 103,889,064 (GRCm39) unclassified probably benign
R5677:Srek1 UTSW 13 103,895,752 (GRCm39) missense probably damaging 0.98
R6135:Srek1 UTSW 13 103,910,894 (GRCm39) missense probably damaging 1.00
R6458:Srek1 UTSW 13 103,880,076 (GRCm39) missense probably benign 0.01
R7406:Srek1 UTSW 13 103,905,890 (GRCm39) missense probably damaging 1.00
R9269:Srek1 UTSW 13 103,889,654 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCTACTGTGTCTTGGCCAATG -3'
(R):5'- AGGCCTCTTCCTTTTGAGAGAG -3'

Sequencing Primer
(F):5'- GTGTCTTGGCCAATGAATCAC -3'
(R):5'- TTTAAGGGACAAGAGAAAAGATACCC -3'
Posted On 2021-01-18