Incidental Mutation 'R8537:Sema5b'
ID659305
Institutional Source Beutler Lab
Gene Symbol Sema5b
Ensembl Gene ENSMUSG00000052133
Gene Namesema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B
SynonymsSemG, Semag, SemG
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8537 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location35541145-35664732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35651609 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 479 (A479V)
Ref Sequence ENSEMBL: ENSMUSP00000057494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050625] [ENSMUST00000120756]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050625
AA Change: A479V

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057494
Gene: ENSMUSG00000052133
AA Change: A479V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Sema 68 479 1.68e-174 SMART
PSI 497 544 9.18e-12 SMART
TSP1 609 662 3.34e-15 SMART
TSP1 667 713 3.42e-12 SMART
TSP1 798 850 1.58e-16 SMART
TSP1 855 907 2.45e-13 SMART
TSP1 910 957 1.02e-1 SMART
transmembrane domain 977 999 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120756
AA Change: A479V

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112536
Gene: ENSMUSG00000052133
AA Change: A479V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Sema 68 479 1.68e-174 SMART
PSI 497 544 9.18e-12 SMART
TSP1 609 662 3.34e-15 SMART
TSP1 667 742 7.61e-10 SMART
TSP1 827 879 1.58e-16 SMART
TSP1 884 936 2.45e-13 SMART
TSP1 939 986 1.02e-1 SMART
transmembrane domain 1006 1028 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin protein family which regulates axon growth during development of the nervous system. The encoded protein has a characteristic Sema domain near the N-terminus, through which semaphorins bind to plexin, and five thrombospondin type 1 repeats in the C-terminal region of the protein. The protein product may be cleaved and exist as a secreted molecule (PMID: 19463192). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display defects in neurite arborization of multiple retinal cell types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,190,550 E579V probably damaging Het
Adgrv1 T A 13: 81,536,372 D1790V probably damaging Het
Avl9 T A 6: 56,728,659 Y175* probably null Het
Bmp2 A T 2: 133,561,282 D251V probably damaging Het
Camsap2 T A 1: 136,277,205 K1191N probably damaging Het
Ccdc102a A C 8: 94,906,056 F431C probably benign Het
Ccdc186 T C 19: 56,810,245 I270M probably damaging Het
Copb2 A G 9: 98,587,619 Q851R probably null Het
Cyp11b2 C T 15: 74,856,167 R22K probably benign Het
Ddx50 A G 10: 62,642,849 F186S probably damaging Het
Dhx38 T C 8: 109,553,380 Y926C probably damaging Het
Dmrt2 T C 19: 25,673,936 M162T possibly damaging Het
Dnah10 G T 5: 124,816,100 G3309V probably damaging Het
Dnajb2 T C 1: 75,239,598 F107S probably damaging Het
Dock8 T A 19: 25,130,506 S867T probably benign Het
Eif2ak1 C A 5: 143,899,069 T526K probably damaging Het
Gm30302 A G 13: 49,786,632 V534A possibly damaging Het
Gnas T C 2: 174,298,601 S188P possibly damaging Het
Gpam T C 19: 55,096,239 D36G probably benign Het
Gucy2e C A 11: 69,236,353 R98L probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpu T C 1: 178,333,634 probably benign Het
Icos A G 1: 60,993,942 D100G probably damaging Het
Ifi203 A T 1: 173,928,906 probably benign Het
Ift46 T A 9: 44,783,983 L92Q probably damaging Het
Kcnip2 C T 19: 45,815,730 probably null Het
Lgr5 T C 10: 115,452,402 Y779C probably damaging Het
Ltk G T 2: 119,758,107 P287Q probably benign Het
Mapk8ip3 A T 17: 24,901,678 C852* probably null Het
Mmp27 A G 9: 7,579,775 M443V probably benign Het
Muc6 T C 7: 141,647,917 D769G probably benign Het
Myo7b T C 18: 31,977,089 I1107V probably benign Het
Nebl T A 2: 17,350,709 H211L probably benign Het
Oaz3 T A 3: 94,436,435 K40N probably damaging Het
Olfr1111 T A 2: 87,150,038 T208S probably benign Het
Olfr860 T A 9: 19,846,552 E22D probably damaging Het
Osbpl10 G T 9: 115,229,909 A718S probably benign Het
Ppp3ca T A 3: 136,797,858 I64K possibly damaging Het
Prlr T C 15: 10,314,180 probably benign Het
Rab3ip A G 10: 116,910,154 I424T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Sec62 G T 3: 30,818,812 R348L unknown Het
Shank3 T C 15: 89,532,215 I222T probably damaging Het
Sp1 C T 15: 102,408,529 T154I possibly damaging Het
Srek1 A G 13: 103,752,449 probably benign Het
Tmem129 A G 5: 33,655,576 S143P possibly damaging Het
Tmem202 A T 9: 59,519,646 C194S probably benign Het
Tmprss15 A T 16: 79,087,515 I93K probably damaging Het
Ttn A G 2: 76,776,309 Y16340H probably damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Other mutations in Sema5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Sema5b APN 16 35651315 missense probably damaging 1.00
IGL01584:Sema5b APN 16 35645423 missense probably damaging 1.00
IGL01859:Sema5b APN 16 35647109 missense possibly damaging 0.94
IGL02195:Sema5b APN 16 35660479 critical splice acceptor site probably null
IGL02346:Sema5b APN 16 35649755 missense probably damaging 1.00
IGL02850:Sema5b APN 16 35660515 missense probably benign 0.01
IGL03277:Sema5b APN 16 35651312 missense probably damaging 0.96
R0101:Sema5b UTSW 16 35663102 splice site probably benign
R0368:Sema5b UTSW 16 35628100 missense probably damaging 1.00
R0426:Sema5b UTSW 16 35646355 missense probably damaging 1.00
R0675:Sema5b UTSW 16 35660333 missense probably benign 0.00
R0905:Sema5b UTSW 16 35622631 missense probably benign 0.33
R1163:Sema5b UTSW 16 35628096 missense probably benign 0.19
R1195:Sema5b UTSW 16 35651660 missense probably null 0.94
R1195:Sema5b UTSW 16 35651660 missense probably null 0.94
R1666:Sema5b UTSW 16 35658482 missense probably benign 0.03
R1706:Sema5b UTSW 16 35649755 missense probably damaging 0.98
R1733:Sema5b UTSW 16 35646367 missense probably damaging 1.00
R1775:Sema5b UTSW 16 35660324 missense probably benign
R2215:Sema5b UTSW 16 35660215 missense probably damaging 1.00
R2844:Sema5b UTSW 16 35659931 missense probably damaging 0.98
R3086:Sema5b UTSW 16 35622723 missense probably benign
R3613:Sema5b UTSW 16 35660150 missense probably benign
R4774:Sema5b UTSW 16 35663182 missense probably damaging 1.00
R5743:Sema5b UTSW 16 35658476 missense probably damaging 1.00
R5856:Sema5b UTSW 16 35646386 nonsense probably null
R5993:Sema5b UTSW 16 35646202 missense probably damaging 1.00
R6248:Sema5b UTSW 16 35628007 splice site probably null
R6420:Sema5b UTSW 16 35663146 missense probably benign 0.08
R6795:Sema5b UTSW 16 35658571 nonsense probably null
R6825:Sema5b UTSW 16 35628007 splice site probably null
R7066:Sema5b UTSW 16 35651312 missense probably benign 0.26
R7244:Sema5b UTSW 16 35660545 missense probably benign
R7446:Sema5b UTSW 16 35647203 missense probably damaging 1.00
R7497:Sema5b UTSW 16 35661330 missense probably damaging 1.00
R7516:Sema5b UTSW 16 35651170 missense probably benign 0.05
R7878:Sema5b UTSW 16 35661626 missense probably benign 0.00
R7922:Sema5b UTSW 16 35658256 frame shift probably null
R8397:Sema5b UTSW 16 35651321 missense possibly damaging 0.59
Z1088:Sema5b UTSW 16 35660590 missense probably damaging 0.99
Z1176:Sema5b UTSW 16 35628018 missense probably benign 0.01
Z1176:Sema5b UTSW 16 35646273 missense probably benign 0.05
Z1176:Sema5b UTSW 16 35649864 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACTCTACATAGGCACGGGTG -3'
(R):5'- GGCTCTGAAACATGATTGGAGG -3'

Sequencing Primer
(F):5'- ATGGCTTCAAGGCTGCTTTC -3'
(R):5'- ATTGGAGGGATAGCCACCACC -3'
Posted On2021-01-18