Incidental Mutation 'R8537:Myo7b'
ID659308
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Namemyosin VIIB
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8537 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location31959234-32036961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31977089 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1107 (I1107V)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
Predicted Effect probably benign
Transcript: ENSMUST00000134663
AA Change: I1107V

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: I1107V

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,190,550 E579V probably damaging Het
Adgrv1 T A 13: 81,536,372 D1790V probably damaging Het
Avl9 T A 6: 56,728,659 Y175* probably null Het
Bmp2 A T 2: 133,561,282 D251V probably damaging Het
Camsap2 T A 1: 136,277,205 K1191N probably damaging Het
Ccdc102a A C 8: 94,906,056 F431C probably benign Het
Ccdc186 T C 19: 56,810,245 I270M probably damaging Het
Copb2 A G 9: 98,587,619 Q851R probably null Het
Cyp11b2 C T 15: 74,856,167 R22K probably benign Het
Ddx50 A G 10: 62,642,849 F186S probably damaging Het
Dhx38 T C 8: 109,553,380 Y926C probably damaging Het
Dmrt2 T C 19: 25,673,936 M162T possibly damaging Het
Dnah10 G T 5: 124,816,100 G3309V probably damaging Het
Dnajb2 T C 1: 75,239,598 F107S probably damaging Het
Dock8 T A 19: 25,130,506 S867T probably benign Het
Eif2ak1 C A 5: 143,899,069 T526K probably damaging Het
Gm30302 A G 13: 49,786,632 V534A possibly damaging Het
Gnas T C 2: 174,298,601 S188P possibly damaging Het
Gpam T C 19: 55,096,239 D36G probably benign Het
Gucy2e C A 11: 69,236,353 R98L probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpu T C 1: 178,333,634 probably benign Het
Icos A G 1: 60,993,942 D100G probably damaging Het
Ifi203 A T 1: 173,928,906 probably benign Het
Ift46 T A 9: 44,783,983 L92Q probably damaging Het
Kcnip2 C T 19: 45,815,730 probably null Het
Lgr5 T C 10: 115,452,402 Y779C probably damaging Het
Ltk G T 2: 119,758,107 P287Q probably benign Het
Mapk8ip3 A T 17: 24,901,678 C852* probably null Het
Mmp27 A G 9: 7,579,775 M443V probably benign Het
Muc6 T C 7: 141,647,917 D769G probably benign Het
Nebl T A 2: 17,350,709 H211L probably benign Het
Oaz3 T A 3: 94,436,435 K40N probably damaging Het
Olfr1111 T A 2: 87,150,038 T208S probably benign Het
Olfr860 T A 9: 19,846,552 E22D probably damaging Het
Osbpl10 G T 9: 115,229,909 A718S probably benign Het
Ppp3ca T A 3: 136,797,858 I64K possibly damaging Het
Prlr T C 15: 10,314,180 probably benign Het
Rab3ip A G 10: 116,910,154 I424T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Sec62 G T 3: 30,818,812 R348L unknown Het
Sema5b C T 16: 35,651,609 A479V possibly damaging Het
Shank3 T C 15: 89,532,215 I222T probably damaging Het
Sp1 C T 15: 102,408,529 T154I possibly damaging Het
Srek1 A G 13: 103,752,449 probably benign Het
Tmem129 A G 5: 33,655,576 S143P possibly damaging Het
Tmem202 A T 9: 59,519,646 C194S probably benign Het
Tmprss15 A T 16: 79,087,515 I93K probably damaging Het
Ttn A G 2: 76,776,309 Y16340H probably damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31959466 missense possibly damaging 0.80
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 splice site probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1623:Myo7b UTSW 18 32000051 missense probably damaging 1.00
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2027:Myo7b UTSW 18 31984960 missense probably benign
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4765:Myo7b UTSW 18 31961900 missense probably benign 0.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5027:Myo7b UTSW 18 31975212 missense probably benign 0.22
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5267:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6137:Myo7b UTSW 18 31999974 missense probably damaging 1.00
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6302:Myo7b UTSW 18 31994386 missense probably damaging 0.98
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R7942:Myo7b UTSW 18 32013369 missense probably damaging 0.98
R8030:Myo7b UTSW 18 31998082 missense probably damaging 0.96
R8114:Myo7b UTSW 18 31965624 missense probably damaging 1.00
R8338:Myo7b UTSW 18 31971355 missense probably damaging 0.96
R8341:Myo7b UTSW 18 31983926 missense probably benign 0.39
R8406:Myo7b UTSW 18 31959813 missense probably damaging 1.00
R8464:Myo7b UTSW 18 31962704 missense probably benign 0.00
R8517:Myo7b UTSW 18 31967191 missense possibly damaging 0.87
R8546:Myo7b UTSW 18 31990148 missense probably benign 0.19
R8721:Myo7b UTSW 18 32007011 missense probably damaging 1.00
R8770:Myo7b UTSW 18 31981071 missense probably benign 0.03
R8841:Myo7b UTSW 18 31964437 missense probably benign 0.06
R8853:Myo7b UTSW 18 31986691 missense possibly damaging 0.67
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 31985056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTATGACCTCTGGACTTGGC -3'
(R):5'- TCAAGCGAAGGAATACCCCG -3'

Sequencing Primer
(F):5'- AGGGCCTGCTCCTGTTGTAAC -3'
(R):5'- CGGAAGGAGGACTGAAAGC -3'
Posted On2021-01-18