Incidental Mutation 'R8539:Ror1'
ID659320
Institutional Source Beutler Lab
Gene Symbol Ror1
Ensembl Gene ENSMUSG00000035305
Gene Namereceptor tyrosine kinase-like orphan receptor 1
Synonyms2810404D04Rik, Ntrkr1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8539 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location100095791-100444765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100441887 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 819 (I819T)
Ref Sequence ENSEMBL: ENSMUSP00000048171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039630]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039630
AA Change: I819T

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: I819T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 70 138 8.37e-15 SMART
Pfam:Fz 170 290 4.9e-13 PFAM
KR 311 393 7.57e-47 SMART
transmembrane domain 404 426 N/A INTRINSIC
TyrKc 473 746 2.46e-137 SMART
low complexity region 753 762 N/A INTRINSIC
low complexity region 817 828 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c6 G A 13: 4,434,475 probably null Het
Amz1 T C 5: 140,748,657 L215S probably benign Het
Aplnr A G 2: 85,136,907 D92G probably benign Het
Arpc5 A G 1: 152,766,801 D26G probably damaging Het
Cntrob G A 11: 69,320,826 R191C possibly damaging Het
Ephb4 A G 5: 137,357,855 D242G probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Galnt13 A T 2: 54,933,572 probably null Het
Hcrt T A 11: 100,761,225 probably benign Het
Hnf1a A G 5: 114,970,517 probably null Het
Hykk A G 9: 54,937,160 S170G probably benign Het
Igf1r C A 7: 68,003,848 Q45K probably benign Het
Klhl8 C T 5: 103,867,526 V511I probably damaging Het
Loxl3 A T 6: 83,049,526 M488L probably benign Het
Myo7a G A 7: 98,072,461 P1221S probably damaging Het
Myom2 A T 8: 15,114,254 I1050F probably benign Het
Ncapd3 T G 9: 27,048,224 C319G probably benign Het
Ndufaf5 C A 2: 140,183,974 T151K possibly damaging Het
Notch3 A T 17: 32,156,355 D364E possibly damaging Het
Nudt21 G A 8: 94,036,973 probably benign Het
Olfr1370 T C 13: 21,073,173 I43V probably benign Het
Pkd1l3 T A 8: 109,636,287 V1060E probably damaging Het
Plxnd1 G C 6: 115,962,807 P1404A possibly damaging Het
Ret A G 6: 118,175,809 V523A possibly damaging Het
Scn10a T A 9: 119,638,774 K767* probably null Het
Sema5a T A 15: 32,618,843 W506R probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sult1b1 C A 5: 87,533,979 V67F possibly damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tap1 C T 17: 34,189,435 A216V probably benign Het
Tlr3 A G 8: 45,398,516 L448P probably damaging Het
Tnik G A 3: 28,542,003 V182M probably damaging Het
Ttn A G 2: 76,906,434 F4329L probably benign Het
Usp21 C T 1: 171,283,673 E396K probably damaging Het
Vmn1r122 A T 7: 21,133,356 I258N possibly damaging Het
Vmn2r106 C A 17: 20,279,009 R213S probably benign Het
Vmn2r111 A T 17: 22,571,293 M244K probably benign Het
Zeb1 T A 18: 5,748,784 V117D probably damaging Het
Other mutations in Ror1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Ror1 APN 4 100333743 missense probably damaging 1.00
IGL00939:Ror1 APN 4 100441226 missense probably benign 0.01
IGL01408:Ror1 APN 4 100333787 missense probably damaging 1.00
IGL01678:Ror1 APN 4 100425968 missense possibly damaging 0.68
IGL01700:Ror1 APN 4 100409771 missense probably damaging 1.00
IGL01985:Ror1 APN 4 100425964 missense possibly damaging 0.94
IGL02002:Ror1 APN 4 100441184 missense probably damaging 1.00
IGL02634:Ror1 APN 4 100426110 missense probably benign 0.00
IGL02995:Ror1 APN 4 100334525 splice site probably benign
IGL03033:Ror1 APN 4 100411895 missense possibly damaging 0.67
IGL03207:Ror1 APN 4 100407945 splice site probably null
F5770:Ror1 UTSW 4 100440933 missense probably damaging 0.99
R0256:Ror1 UTSW 4 100409745 missense probably benign 0.20
R0417:Ror1 UTSW 4 100412000 missense possibly damaging 0.94
R0525:Ror1 UTSW 4 100441520 missense probably damaging 1.00
R1034:Ror1 UTSW 4 100333620 nonsense probably null
R1278:Ror1 UTSW 4 100441878 missense possibly damaging 0.69
R1368:Ror1 UTSW 4 100441137 missense possibly damaging 0.94
R1437:Ror1 UTSW 4 100412109 missense probably benign
R1441:Ror1 UTSW 4 100440983 missense probably benign
R1544:Ror1 UTSW 4 100441986 missense probably damaging 1.00
R1717:Ror1 UTSW 4 100302938 missense probably benign
R1857:Ror1 UTSW 4 100441503 missense probably damaging 1.00
R2018:Ror1 UTSW 4 100407841 nonsense probably null
R2051:Ror1 UTSW 4 100407868 nonsense probably null
R2127:Ror1 UTSW 4 100442093 missense probably benign
R2132:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2133:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2176:Ror1 UTSW 4 100441874 missense probably damaging 0.99
R2431:Ror1 UTSW 4 100441155 missense probably damaging 1.00
R2896:Ror1 UTSW 4 100096280 missense unknown
R3005:Ror1 UTSW 4 100441764 missense probably damaging 0.99
R3780:Ror1 UTSW 4 100412117 missense probably benign 0.34
R3850:Ror1 UTSW 4 100442160 missense possibly damaging 0.90
R3861:Ror1 UTSW 4 100407923 missense possibly damaging 0.46
R4599:Ror1 UTSW 4 100407910 missense probably damaging 0.99
R4863:Ror1 UTSW 4 100409804 missense probably damaging 0.99
R4871:Ror1 UTSW 4 100425998 missense probably benign
R4990:Ror1 UTSW 4 100441964 missense probably benign
R5023:Ror1 UTSW 4 100425932 missense probably benign 0.01
R5028:Ror1 UTSW 4 100411936 missense possibly damaging 0.67
R5079:Ror1 UTSW 4 100441422 missense probably damaging 1.00
R5294:Ror1 UTSW 4 100425938 missense probably benign 0.00
R5538:Ror1 UTSW 4 100441011 missense probably benign
R6339:Ror1 UTSW 4 100411931 missense possibly damaging 0.91
R6491:Ror1 UTSW 4 100409912 missense possibly damaging 0.94
R6632:Ror1 UTSW 4 100442106 missense probably benign
R6733:Ror1 UTSW 4 100426055 missense probably benign
R7022:Ror1 UTSW 4 100407911 missense probably damaging 1.00
R7054:Ror1 UTSW 4 100442239 missense probably benign 0.00
R7121:Ror1 UTSW 4 100302945 missense probably benign 0.00
R7350:Ror1 UTSW 4 100425943 missense probably benign 0.00
R7492:Ror1 UTSW 4 100441059 missense probably benign 0.22
R7502:Ror1 UTSW 4 100333630 missense probably benign 0.03
R7531:Ror1 UTSW 4 100441191 missense probably damaging 1.00
R7661:Ror1 UTSW 4 100441490 missense probably damaging 1.00
R7822:Ror1 UTSW 4 100441367 missense probably damaging 1.00
R7831:Ror1 UTSW 4 100441098 missense probably benign 0.01
R8366:Ror1 UTSW 4 100409998 missense possibly damaging 0.91
R8757:Ror1 UTSW 4 100440883 missense probably benign 0.01
R8862:Ror1 UTSW 4 100334518 critical splice donor site probably null
V7580:Ror1 UTSW 4 100440933 missense probably damaging 0.99
V7583:Ror1 UTSW 4 100440933 missense probably damaging 0.99
X0020:Ror1 UTSW 4 100426090 missense probably benign 0.02
Z1177:Ror1 UTSW 4 100302919 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAAGACATCCACGTCCGGC -3'
(R):5'- ATCCTGATGAGGGCAAGCTG -3'

Sequencing Primer
(F):5'- GAGGGCCTCTCAAGTCACAC -3'
(R):5'- GCAAGCTGGCCACATGG -3'
Posted On2021-01-18