Mutagenetix > Incidental Mutation

Incidental Mutation 'R8539:Ephb4'

659324

Institutional Source

Beutler Lab

Gene Symbol

Ephb4

Ensembl Gene

ENSMUSG00000029710

Gene Name

Eph receptor B4

Synonyms

MDK2, Htk, Myk1, Tyro11

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8539 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

137350109-137378669 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 137357855 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 242 (D242G)

Ref Sequence

ENSEMBL: ENSMUSP00000130275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]

AlphaFold

P54761

Predicted Effect

probably damaging
Transcript: ENSMUST00000061244
AA Change: D242G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: D242G

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111054
AA Change: D242G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: D242G

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	1.4e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	3.4e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
Pfam:SAM_1	882	917	2.6e-7	PFAM
low complexity region	919	934	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111055
AA Change: D242G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: D242G

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	4.2e-10	PFAM
FN3	324	413	1.75e-6	SMART
FN3	443	525	1.07e-10	SMART
Pfam:EphA2_TM	550	621	5e-24	PFAM
TyrKc	624	883	5.09e-130	SMART
SAM	913	980	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000144296
AA Change: D242G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: D242G

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166239
AA Change: D242G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: D242G

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c6	G	A	13: 4,434,475		probably null	Het
Amz1	T	C	5: 140,748,657	L215S	probably benign	Het
Aplnr	A	G	2: 85,136,907	D92G	probably benign	Het
Arpc5	A	G	1: 152,766,801	D26G	probably damaging	Het
Cntrob	G	A	11: 69,320,826	R191C	possibly damaging	Het
Eppk1	C	T	15: 76,110,119	R854Q	probably benign	Het
Galnt13	A	T	2: 54,933,572		probably null	Het
Hcrt	T	A	11: 100,761,225		probably benign	Het
Hnf1a	A	G	5: 114,970,517		probably null	Het
Hykk	A	G	9: 54,937,160	S170G	probably benign	Het
Igf1r	C	A	7: 68,003,848	Q45K	probably benign	Het
Klhl8	C	T	5: 103,867,526	V511I	probably damaging	Het
Loxl3	A	T	6: 83,049,526	M488L	probably benign	Het
Myo7a	G	A	7: 98,072,461	P1221S	probably damaging	Het
Myom2	A	T	8: 15,114,254	I1050F	probably benign	Het
Ncapd3	T	G	9: 27,048,224	C319G	probably benign	Het
Ndufaf5	C	A	2: 140,183,974	T151K	possibly damaging	Het
Notch3	A	T	17: 32,156,355	D364E	possibly damaging	Het
Nudt21	G	A	8: 94,036,973		probably benign	Het
Olfr1370	T	C	13: 21,073,173	I43V	probably benign	Het
Pkd1l3	T	A	8: 109,636,287	V1060E	probably damaging	Het
Plxnd1	G	C	6: 115,962,807	P1404A	possibly damaging	Het
Ret	A	G	6: 118,175,809	V523A	possibly damaging	Het
Ror1	T	C	4: 100,441,887	I819T	possibly damaging	Het
Scn10a	T	A	9: 119,638,774	K767*	probably null	Het
Sema5a	T	A	15: 32,618,843	W506R	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Sult1b1	C	A	5: 87,533,979	V67F	possibly damaging	Het
Suz12	T	A	11: 79,999,078	D13E	probably damaging	Het
Tap1	C	T	17: 34,189,435	A216V	probably benign	Het
Tlr3	A	G	8: 45,398,516	L448P	probably damaging	Het
Tnik	G	A	3: 28,542,003	V182M	probably damaging	Het
Ttn	A	G	2: 76,906,434	F4329L	probably benign	Het
Usp21	C	T	1: 171,283,673	E396K	probably damaging	Het
Vmn1r122	A	T	7: 21,133,356	I258N	possibly damaging	Het
Vmn2r106	C	A	17: 20,279,009	R213S	probably benign	Het
Vmn2r111	A	T	17: 22,571,293	M244K	probably benign	Het
Zeb1	T	A	18: 5,748,784	V117D	probably damaging	Het

Other mutations in Ephb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00542:Ephb4	APN	5	137365615	splice site	probably benign
IGL00948:Ephb4	APN	5	137366659	missense	probably damaging	1.00
IGL01653:Ephb4	APN	5	137365741	splice site	probably benign
IGL01885:Ephb4	APN	5	137357797	missense	probably damaging	1.00
IGL01906:Ephb4	APN	5	137361194	missense	probably damaging	1.00
IGL02089:Ephb4	APN	5	137370762	missense	probably damaging	0.98
IGL02216:Ephb4	APN	5	137372070	missense	possibly damaging	0.92
IGL02233:Ephb4	APN	5	137354501	nonsense	probably null
IGL03080:Ephb4	APN	5	137354083	splice site	probably benign
IGL03111:Ephb4	APN	5	137372505	missense	probably benign	0.07
R0599:Ephb4	UTSW	5	137369855	missense	probably damaging	1.00
R0744:Ephb4	UTSW	5	137365667	missense	probably damaging	1.00
R1331:Ephb4	UTSW	5	137366534	splice site	probably benign
R1441:Ephb4	UTSW	5	137361247	missense	probably damaging	1.00
R1732:Ephb4	UTSW	5	137372178	missense	possibly damaging	0.93
R1745:Ephb4	UTSW	5	137360434	missense	probably benign
R1831:Ephb4	UTSW	5	137354415	missense	probably damaging	1.00
R1865:Ephb4	UTSW	5	137363310	missense	possibly damaging	0.53
R2165:Ephb4	UTSW	5	137354426	missense	probably benign	0.08
R2206:Ephb4	UTSW	5	137357719	missense	probably damaging	1.00
R2473:Ephb4	UTSW	5	137365700	missense	probably benign	0.15
R4779:Ephb4	UTSW	5	137365702	missense	probably benign	0.04
R4801:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R4802:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R5307:Ephb4	UTSW	5	137363312	missense	probably damaging	1.00
R5452:Ephb4	UTSW	5	137361142	missense	probably damaging	1.00
R5458:Ephb4	UTSW	5	137369852	missense	probably damaging	1.00
R5475:Ephb4	UTSW	5	137354439	missense	probably benign	0.00
R5662:Ephb4	UTSW	5	137372195	missense	probably damaging	0.98
R5879:Ephb4	UTSW	5	137360416	missense	probably benign	0.00
R6336:Ephb4	UTSW	5	137372085	missense	probably damaging	1.00
R6443:Ephb4	UTSW	5	137360449	missense	probably damaging	1.00
R6632:Ephb4	UTSW	5	137366587	missense	probably damaging	0.99
R6973:Ephb4	UTSW	5	137369804	missense	probably damaging	1.00
R7008:Ephb4	UTSW	5	137361274	missense	probably benign	0.00
R7145:Ephb4	UTSW	5	137372046	missense	probably damaging	1.00
R7421:Ephb4	UTSW	5	137354425	missense	possibly damaging	0.88
R7593:Ephb4	UTSW	5	137361298	missense	probably benign
R7635:Ephb4	UTSW	5	137372103	missense	probably damaging	1.00
R7751:Ephb4	UTSW	5	137365675	missense	probably damaging	1.00
R7825:Ephb4	UTSW	5	137372437	missense	probably damaging	1.00
R8904:Ephb4	UTSW	5	137370805	missense	probably damaging	1.00
R9228:Ephb4	UTSW	5	137354562	missense	possibly damaging	0.79
R9327:Ephb4	UTSW	5	137363267	missense	probably damaging	0.99
R9513:Ephb4	UTSW	5	137363302	missense	possibly damaging	0.76
R9659:Ephb4	UTSW	5	137365481	missense	probably damaging	1.00
R9788:Ephb4	UTSW	5	137365481	missense	probably damaging	1.00
X0026:Ephb4	UTSW	5	137373558	missense	probably damaging	1.00
Z1177:Ephb4	UTSW	5	137361359	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AAAGCTGGCTTCTACCTGGC -3'
(R):5'- TACTACCAATCAGCGGAATTAACAG -3'

Sequencing Primer
(F):5'- TTTCCAGGACCAAGGAGCCTG -3'
(R):5'- CTATTCTAAGAATAAAATCCGAGGGG -3'

Posted On

2021-01-18