Mutagenetix > Incidental Mutations

Incidental Mutation 'R8539:Plxnd1'

659327

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

b2b553Clo, 6230425C21Rik, b2b1863Clo

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8539 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

115954811-115995005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 115962807 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Alanine at position 1404 (P1404A)

Ref Sequence

ENSEMBL: ENSMUSP00000015511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000015511
AA Change: P1404A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: P1404A

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131590

SMART Domains

Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

Domain	Start	End	E-Value	Type
Blast:PSI	2	34	1e-13	BLAST
IPT	35	124	4.43e-20	SMART
Blast:IPT	125	177	3e-30	BLAST
Pfam:TIG	180	233	4.6e-6	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c6	G	A	13: 4,434,475		probably null	Het
Amz1	T	C	5: 140,748,657	L215S	probably benign	Het
Aplnr	A	G	2: 85,136,907	D92G	probably benign	Het
Arpc5	A	G	1: 152,766,801	D26G	probably damaging	Het
Cntrob	G	A	11: 69,320,826	R191C	possibly damaging	Het
Ephb4	A	G	5: 137,357,855	D242G	probably damaging	Het
Eppk1	C	T	15: 76,110,119	R854Q	probably benign	Het
Hcrt	T	A	11: 100,761,225		probably benign	Het
Hnf1a	A	G	5: 114,970,517		probably null	Het
Hykk	A	G	9: 54,937,160	S170G	probably benign	Het
Igf1r	C	A	7: 68,003,848	Q45K	probably benign	Het
Klhl8	C	T	5: 103,867,526	V511I	probably damaging	Het
Loxl3	A	T	6: 83,049,526	M488L	probably benign	Het
Myo7a	G	A	7: 98,072,461	P1221S	probably damaging	Het
Myom2	A	T	8: 15,114,254	I1050F	probably benign	Het
Ncapd3	T	G	9: 27,048,224	C319G	probably benign	Het
Ndufaf5	C	A	2: 140,183,974	T151K	possibly damaging	Het
Notch3	A	T	17: 32,156,355	D364E	possibly damaging	Het
Nudt21	G	A	8: 94,036,973		probably benign	Het
Olfr1370	T	C	13: 21,073,173	I43V	probably benign	Het
Pkd1l3	T	A	8: 109,636,287	V1060E	probably damaging	Het
Ret	A	G	6: 118,175,809	V523A	possibly damaging	Het
Ror1	T	C	4: 100,441,887	I819T	possibly damaging	Het
Scn10a	T	A	9: 119,638,774	K767*	probably null	Het
Sema5a	T	A	15: 32,618,843	W506R	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Sult1b1	C	A	5: 87,533,979	V67F	possibly damaging	Het
Suz12	T	A	11: 79,999,078	D13E	probably damaging	Het
Tap1	C	T	17: 34,189,435	A216V	probably benign	Het
Tlr3	A	G	8: 45,398,516	L448P	probably damaging	Het
Tnik	G	A	3: 28,542,003	V182M	probably damaging	Het
Ttn	A	G	2: 76,906,434	F4329L	probably benign	Het
Usp21	C	T	1: 171,283,673	E396K	probably damaging	Het
Vmn1r122	A	T	7: 21,133,356	I258N	possibly damaging	Het
Vmn2r106	C	A	17: 20,279,009	R213S	probably benign	Het
Vmn2r111	A	T	17: 22,571,293	M244K	probably benign	Het
Zeb1	T	A	18: 5,748,784	V117D	probably damaging	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115967972	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115969945	missense	probably benign
IGL01323:Plxnd1	APN	6	115966799	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115960527	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115959935	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115978257	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115993628	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115963913	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115955742	makesense	probably null
IGL02873:Plxnd1	APN	6	115959976	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115962357	missense	probably damaging	1.00
Hiss	UTSW	6	115969929	missense	possibly damaging	0.94
murmer	UTSW	6	115968793	missense	probably benign	0.00
mutter	UTSW	6	115968044	missense	probably benign	0.27
rattle	UTSW	6	115959794	missense	probably damaging	0.96
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115969460	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115958699	splice site	probably benign
R0648:Plxnd1	UTSW	6	115994001	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115966638	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115967005	splice site	probably null
R1292:Plxnd1	UTSW	6	115962683	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115968681	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115967779	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115994057	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115980601	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115966546	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115963914	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115969441	splice site	probably null
R1865:Plxnd1	UTSW	6	115969441	splice site	probably null
R1875:Plxnd1	UTSW	6	115978084	splice site	probably null
R1899:Plxnd1	UTSW	6	115969363	missense	probably benign
R1913:Plxnd1	UTSW	6	115978017	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115962517	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115967255	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115957548	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115962764	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115964144	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115962743	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115967748	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115959315	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115965953	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115956094	splice site	probably benign
R4280:Plxnd1	UTSW	6	115956095	splice site	probably null
R4346:Plxnd1	UTSW	6	115977980	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115993976	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115955756	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115968044	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115994276	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115972525	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115958615	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115958620	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115960855	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115955765	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115994376	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115965901	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115958988	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115957648	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115965877	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115968688	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115967787	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115978174	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115977960	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115978492	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115976736	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115969929	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115993763	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115972507	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115960837	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115976639	missense	probably benign
R7699:Plxnd1	UTSW	6	115959794	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115966918	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115956617	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115972472	missense	probably benign
R8507:Plxnd1	UTSW	6	115966905	missense	probably damaging	0.97
R8548:Plxnd1	UTSW	6	115957597	missense	probably damaging	1.00
X0024:Plxnd1	UTSW	6	115963310	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115966784	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115967510	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGTGGCCAATGAGGAATGC -3'
(R):5'- CGCTGGTTAGATAGAAACTGGCAC -3'

Sequencing Primer
(F):5'- AGGAATGCCTGGGGAGG -3'
(R):5'- CACAGAGTGGATATGGGGCTCC -3'

Posted On

2021-01-18