Incidental Mutation 'R8539:Igf1r'
ID 659330
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Name insulin-like growth factor I receptor
Synonyms IGF-1R, line 186, A330103N21Rik, hyft, CD221
MMRRC Submission 068505-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8539 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 67602575-67883416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 67653596 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 45 (Q45K)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005671
AA Change: Q45K

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: Q45K

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c6 G A 13: 4,484,474 (GRCm39) probably null Het
Amz1 T C 5: 140,734,412 (GRCm39) L215S probably benign Het
Aplnr A G 2: 84,967,251 (GRCm39) D92G probably benign Het
Arpc5 A G 1: 152,642,552 (GRCm39) D26G probably damaging Het
Cntrob G A 11: 69,211,652 (GRCm39) R191C possibly damaging Het
Ephb4 A G 5: 137,356,117 (GRCm39) D242G probably damaging Het
Eppk1 C T 15: 75,994,319 (GRCm39) R854Q probably benign Het
Galnt13 A T 2: 54,823,584 (GRCm39) probably null Het
Hcrt T A 11: 100,652,051 (GRCm39) probably benign Het
Hnf1a A G 5: 115,108,576 (GRCm39) probably null Het
Hykk A G 9: 54,844,444 (GRCm39) S170G probably benign Het
Klhl8 C T 5: 104,015,392 (GRCm39) V511I probably damaging Het
Loxl3 A T 6: 83,026,507 (GRCm39) M488L probably benign Het
Myo7a G A 7: 97,721,668 (GRCm39) P1221S probably damaging Het
Myom2 A T 8: 15,164,254 (GRCm39) I1050F probably benign Het
Ncapd3 T G 9: 26,959,520 (GRCm39) C319G probably benign Het
Ndufaf5 C A 2: 140,025,894 (GRCm39) T151K possibly damaging Het
Notch3 A T 17: 32,375,329 (GRCm39) D364E possibly damaging Het
Nudt21 G A 8: 94,763,601 (GRCm39) probably benign Het
Or2p2 T C 13: 21,257,343 (GRCm39) I43V probably benign Het
Pkd1l3 T A 8: 110,362,919 (GRCm39) V1060E probably damaging Het
Plxnd1 G C 6: 115,939,768 (GRCm39) P1404A possibly damaging Het
Ret A G 6: 118,152,770 (GRCm39) V523A possibly damaging Het
Ror1 T C 4: 100,299,084 (GRCm39) I819T possibly damaging Het
Scn10a T A 9: 119,467,840 (GRCm39) K767* probably null Het
Sema5a T A 15: 32,618,989 (GRCm39) W506R probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Sult1b1 C A 5: 87,681,838 (GRCm39) V67F possibly damaging Het
Suz12 T A 11: 79,889,904 (GRCm39) D13E probably damaging Het
Tap1 C T 17: 34,408,409 (GRCm39) A216V probably benign Het
Tlr3 A G 8: 45,851,553 (GRCm39) L448P probably damaging Het
Tnik G A 3: 28,596,152 (GRCm39) V182M probably damaging Het
Ttn A G 2: 76,736,778 (GRCm39) F4329L probably benign Het
Usp21 C T 1: 171,111,246 (GRCm39) E396K probably damaging Het
Vmn1r122 A T 7: 20,867,281 (GRCm39) I258N possibly damaging Het
Vmn2r106 C A 17: 20,499,271 (GRCm39) R213S probably benign Het
Vmn2r111 A T 17: 22,790,274 (GRCm39) M244K probably benign Het
Zeb1 T A 18: 5,748,784 (GRCm39) V117D probably damaging Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 67,839,771 (GRCm39) missense probably benign
IGL00837:Igf1r APN 7 67,851,100 (GRCm39) splice site probably benign
IGL01515:Igf1r APN 7 67,857,200 (GRCm39) missense probably damaging 1.00
IGL01572:Igf1r APN 7 67,843,189 (GRCm39) missense probably benign 0.01
IGL02100:Igf1r APN 7 67,839,706 (GRCm39) missense probably benign 0.05
IGL02506:Igf1r APN 7 67,843,144 (GRCm39) missense probably benign
IGL02672:Igf1r APN 7 67,839,781 (GRCm39) missense probably benign 0.05
IGL02701:Igf1r APN 7 67,850,997 (GRCm39) missense possibly damaging 0.93
IGL02742:Igf1r APN 7 67,839,739 (GRCm39) missense possibly damaging 0.94
IGL03073:Igf1r APN 7 67,864,791 (GRCm39) missense probably damaging 1.00
IGL03257:Igf1r APN 7 67,864,688 (GRCm39) missense probably damaging 1.00
Frufru UTSW 7 67,653,911 (GRCm39) missense probably damaging 1.00
Hungarian UTSW 7 67,864,745 (GRCm39) missense probably damaging 1.00
Mimi UTSW 7 67,844,774 (GRCm39) missense possibly damaging 0.67
Piroshka UTSW 7 67,857,084 (GRCm39) nonsense probably null
Romanian UTSW 7 67,653,885 (GRCm39) missense possibly damaging 0.94
Sublime UTSW 7 67,653,927 (GRCm39) missense probably damaging 1.00
Toy UTSW 7 67,653,720 (GRCm39) missense probably damaging 1.00
BB009:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
BB019:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 67,875,934 (GRCm39) small insertion probably benign
FR4737:Igf1r UTSW 7 67,875,929 (GRCm39) small insertion probably benign
FR4976:Igf1r UTSW 7 67,875,934 (GRCm39) small insertion probably benign
FR4976:Igf1r UTSW 7 67,875,929 (GRCm39) small insertion probably benign
PIT4445001:Igf1r UTSW 7 67,857,211 (GRCm39) missense probably damaging 1.00
R0003:Igf1r UTSW 7 67,814,990 (GRCm39) missense probably damaging 1.00
R0184:Igf1r UTSW 7 67,875,941 (GRCm39) missense possibly damaging 0.84
R0538:Igf1r UTSW 7 67,857,574 (GRCm39) missense probably damaging 1.00
R0632:Igf1r UTSW 7 67,814,903 (GRCm39) missense probably damaging 1.00
R0727:Igf1r UTSW 7 67,861,906 (GRCm39) critical splice donor site probably null
R0750:Igf1r UTSW 7 67,861,839 (GRCm39) missense probably damaging 0.99
R1104:Igf1r UTSW 7 67,844,774 (GRCm39) missense possibly damaging 0.67
R1169:Igf1r UTSW 7 67,814,875 (GRCm39) missense probably benign 0.00
R1348:Igf1r UTSW 7 67,868,216 (GRCm39) missense probably damaging 1.00
R1471:Igf1r UTSW 7 67,653,585 (GRCm39) missense probably damaging 0.98
R1580:Igf1r UTSW 7 67,857,617 (GRCm39) missense probably benign
R1745:Igf1r UTSW 7 67,819,661 (GRCm39) missense probably damaging 1.00
R1772:Igf1r UTSW 7 67,844,822 (GRCm39) missense probably benign 0.03
R1789:Igf1r UTSW 7 67,864,681 (GRCm39) nonsense probably null
R1823:Igf1r UTSW 7 67,844,729 (GRCm39) missense possibly damaging 0.77
R1902:Igf1r UTSW 7 67,850,997 (GRCm39) missense possibly damaging 0.93
R1962:Igf1r UTSW 7 67,857,023 (GRCm39) missense probably damaging 0.99
R2179:Igf1r UTSW 7 67,653,698 (GRCm39) missense probably damaging 0.99
R2215:Igf1r UTSW 7 67,814,982 (GRCm39) missense probably benign
R2221:Igf1r UTSW 7 67,851,710 (GRCm39) missense probably damaging 1.00
R2233:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R2234:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R2235:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R3023:Igf1r UTSW 7 67,833,147 (GRCm39) missense probably benign 0.00
R4044:Igf1r UTSW 7 67,839,810 (GRCm39) missense possibly damaging 0.83
R4226:Igf1r UTSW 7 67,844,826 (GRCm39) nonsense probably null
R4387:Igf1r UTSW 7 67,819,757 (GRCm39) missense probably benign
R4388:Igf1r UTSW 7 67,819,757 (GRCm39) missense probably benign
R4728:Igf1r UTSW 7 67,839,372 (GRCm39) missense probably damaging 1.00
R4781:Igf1r UTSW 7 67,814,947 (GRCm39) missense possibly damaging 0.75
R5254:Igf1r UTSW 7 67,857,067 (GRCm39) missense probably damaging 0.99
R5278:Igf1r UTSW 7 67,843,166 (GRCm39) missense possibly damaging 0.78
R5510:Igf1r UTSW 7 67,843,107 (GRCm39) missense probably benign 0.19
R5522:Igf1r UTSW 7 67,833,258 (GRCm39) missense probably damaging 0.96
R5527:Igf1r UTSW 7 67,857,569 (GRCm39) missense probably damaging 1.00
R5761:Igf1r UTSW 7 67,857,001 (GRCm39) missense probably damaging 1.00
R5849:Igf1r UTSW 7 67,839,781 (GRCm39) missense probably benign
R6189:Igf1r UTSW 7 67,857,084 (GRCm39) nonsense probably null
R6262:Igf1r UTSW 7 67,653,720 (GRCm39) missense probably damaging 1.00
R6285:Igf1r UTSW 7 67,653,885 (GRCm39) missense possibly damaging 0.94
R6318:Igf1r UTSW 7 67,814,981 (GRCm39) missense probably benign 0.02
R6365:Igf1r UTSW 7 67,839,798 (GRCm39) missense probably benign 0.26
R6377:Igf1r UTSW 7 67,850,998 (GRCm39) missense probably benign 0.00
R6831:Igf1r UTSW 7 67,857,067 (GRCm39) missense possibly damaging 0.75
R6848:Igf1r UTSW 7 67,653,927 (GRCm39) missense probably damaging 1.00
R6902:Igf1r UTSW 7 67,653,911 (GRCm39) missense probably damaging 1.00
R7193:Igf1r UTSW 7 67,836,905 (GRCm39) missense probably damaging 1.00
R7373:Igf1r UTSW 7 67,844,826 (GRCm39) nonsense probably null
R7442:Igf1r UTSW 7 67,823,026 (GRCm39) missense probably damaging 1.00
R7903:Igf1r UTSW 7 67,834,500 (GRCm39) missense probably damaging 1.00
R7923:Igf1r UTSW 7 67,839,849 (GRCm39) missense probably damaging 1.00
R7932:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
R8368:Igf1r UTSW 7 67,836,796 (GRCm39) missense probably benign 0.03
R8458:Igf1r UTSW 7 67,845,377 (GRCm39) missense probably benign
R8704:Igf1r UTSW 7 67,819,802 (GRCm39) splice site probably benign
R8746:Igf1r UTSW 7 67,864,745 (GRCm39) missense probably damaging 1.00
R8829:Igf1r UTSW 7 67,875,769 (GRCm39) missense probably damaging 1.00
R8832:Igf1r UTSW 7 67,875,769 (GRCm39) missense probably damaging 1.00
R8859:Igf1r UTSW 7 67,833,211 (GRCm39) missense possibly damaging 0.75
R9057:Igf1r UTSW 7 67,833,186 (GRCm39) missense probably damaging 1.00
R9243:Igf1r UTSW 7 67,861,775 (GRCm39) missense probably benign 0.11
R9342:Igf1r UTSW 7 67,844,746 (GRCm39) missense probably benign 0.00
R9412:Igf1r UTSW 7 67,857,001 (GRCm39) missense probably damaging 1.00
R9525:Igf1r UTSW 7 67,864,682 (GRCm39) missense probably damaging 1.00
R9727:Igf1r UTSW 7 67,857,554 (GRCm39) missense probably damaging 1.00
R9730:Igf1r UTSW 7 67,839,423 (GRCm39) missense probably damaging 1.00
R9779:Igf1r UTSW 7 67,654,065 (GRCm39) missense probably damaging 1.00
RF025:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
RF032:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
RF034:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF037:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF039:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF044:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,916 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,930 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,928 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,922 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,917 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,918 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,917 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,921 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGTAACCAGGTAGCTGTGCG -3'
(R):5'- ATGACCAGTGCGTAGTTGTAG -3'

Sequencing Primer
(F):5'- TGCGGGTGTGCACTCTG -3'
(R):5'- GTTGTAGAAGAGTTTCCAGCCAC -3'
Posted On 2021-01-18