Incidental Mutation 'R8539:Hykk'
ID 659337
Institutional Source Beutler Lab
Gene Symbol Hykk
Ensembl Gene ENSMUSG00000035878
Gene Name hydroxylysine kinase 1
Synonyms Agphd1, C630028N24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R8539 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 54917283-54949924 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54937160 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 170 (S170G)
Ref Sequence ENSEMBL: ENSMUSP00000039980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039742]
AlphaFold Q5U5V2
Predicted Effect probably benign
Transcript: ENSMUST00000039742
AA Change: S170G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039980
Gene: ENSMUSG00000035878
AA Change: S170G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:APH 36 300 2.2e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c6 G A 13: 4,434,475 probably null Het
Amz1 T C 5: 140,748,657 L215S probably benign Het
Aplnr A G 2: 85,136,907 D92G probably benign Het
Arpc5 A G 1: 152,766,801 D26G probably damaging Het
Cntrob G A 11: 69,320,826 R191C possibly damaging Het
Ephb4 A G 5: 137,357,855 D242G probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Galnt13 A T 2: 54,933,572 probably null Het
Hcrt T A 11: 100,761,225 probably benign Het
Hnf1a A G 5: 114,970,517 probably null Het
Igf1r C A 7: 68,003,848 Q45K probably benign Het
Klhl8 C T 5: 103,867,526 V511I probably damaging Het
Loxl3 A T 6: 83,049,526 M488L probably benign Het
Myo7a G A 7: 98,072,461 P1221S probably damaging Het
Myom2 A T 8: 15,114,254 I1050F probably benign Het
Ncapd3 T G 9: 27,048,224 C319G probably benign Het
Ndufaf5 C A 2: 140,183,974 T151K possibly damaging Het
Notch3 A T 17: 32,156,355 D364E possibly damaging Het
Nudt21 G A 8: 94,036,973 probably benign Het
Olfr1370 T C 13: 21,073,173 I43V probably benign Het
Pkd1l3 T A 8: 109,636,287 V1060E probably damaging Het
Plxnd1 G C 6: 115,962,807 P1404A possibly damaging Het
Ret A G 6: 118,175,809 V523A possibly damaging Het
Ror1 T C 4: 100,441,887 I819T possibly damaging Het
Scn10a T A 9: 119,638,774 K767* probably null Het
Sema5a T A 15: 32,618,843 W506R probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sult1b1 C A 5: 87,533,979 V67F possibly damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tap1 C T 17: 34,189,435 A216V probably benign Het
Tlr3 A G 8: 45,398,516 L448P probably damaging Het
Tnik G A 3: 28,542,003 V182M probably damaging Het
Ttn A G 2: 76,906,434 F4329L probably benign Het
Usp21 C T 1: 171,283,673 E396K probably damaging Het
Vmn1r122 A T 7: 21,133,356 I258N possibly damaging Het
Vmn2r106 C A 17: 20,279,009 R213S probably benign Het
Vmn2r111 A T 17: 22,571,293 M244K probably benign Het
Zeb1 T A 18: 5,748,784 V117D probably damaging Het
Other mutations in Hykk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Hykk APN 9 54920558 missense possibly damaging 0.83
IGL02890:Hykk APN 9 54920711 missense probably benign 0.04
hike UTSW 9 54946479 missense probably benign 0.00
spatziergangen UTSW 9 54920726 missense possibly damaging 0.53
BB001:Hykk UTSW 9 54922240 missense probably damaging 1.00
BB011:Hykk UTSW 9 54922240 missense probably damaging 1.00
R0070:Hykk UTSW 9 54922348 splice site probably benign
R0734:Hykk UTSW 9 54946432 missense possibly damaging 0.93
R0830:Hykk UTSW 9 54937317 missense probably damaging 1.00
R1905:Hykk UTSW 9 54946383 missense probably benign
R2322:Hykk UTSW 9 54946134 missense probably benign 0.00
R4632:Hykk UTSW 9 54946516 missense probably benign 0.01
R4846:Hykk UTSW 9 54920606 missense probably damaging 1.00
R5088:Hykk UTSW 9 54946479 missense probably benign 0.00
R5410:Hykk UTSW 9 54946066 missense probably damaging 1.00
R6292:Hykk UTSW 9 54920826 critical splice donor site probably null
R6416:Hykk UTSW 9 54946359 missense probably benign 0.03
R6983:Hykk UTSW 9 54946509 missense probably benign 0.00
R7261:Hykk UTSW 9 54920726 missense possibly damaging 0.53
R7276:Hykk UTSW 9 54946218 missense probably damaging 1.00
R7924:Hykk UTSW 9 54922240 missense probably damaging 1.00
Z1177:Hykk UTSW 9 54946429 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGATGCACTGGTGAAAATGTATG -3'
(R):5'- GAAACACACATACGTTGATTGGG -3'

Sequencing Primer
(F):5'- GGTAGGCCCAGACTCACTATTTAG -3'
(R):5'- GATTGGGAAAATACTCACATTCTCG -3'
Posted On 2021-01-18