Incidental Mutation 'R8539:Cntrob'
ID 659339
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
MMRRC Submission 068505-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R8539 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 69211652 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 191 (R191C)
Ref Sequence ENSEMBL: ENSMUSP00000090651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060956] [ENSMUST00000092973] [ENSMUST00000102601] [ENSMUST00000102602] [ENSMUST00000108662] [ENSMUST00000123176]
AlphaFold Q8CB62
Predicted Effect probably benign
Transcript: ENSMUST00000060956
SMART Domains Protein: ENSMUSP00000050153
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 109 2.2e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092973
AA Change: R191C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: R191C

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102601
SMART Domains Protein: ENSMUSP00000099661
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 137 1.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102602
SMART Domains Protein: ENSMUSP00000099662
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 137 1.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108662
SMART Domains Protein: ENSMUSP00000104302
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 127 2.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c6 G A 13: 4,484,474 (GRCm39) probably null Het
Amz1 T C 5: 140,734,412 (GRCm39) L215S probably benign Het
Aplnr A G 2: 84,967,251 (GRCm39) D92G probably benign Het
Arpc5 A G 1: 152,642,552 (GRCm39) D26G probably damaging Het
Ephb4 A G 5: 137,356,117 (GRCm39) D242G probably damaging Het
Eppk1 C T 15: 75,994,319 (GRCm39) R854Q probably benign Het
Galnt13 A T 2: 54,823,584 (GRCm39) probably null Het
Hcrt T A 11: 100,652,051 (GRCm39) probably benign Het
Hnf1a A G 5: 115,108,576 (GRCm39) probably null Het
Hykk A G 9: 54,844,444 (GRCm39) S170G probably benign Het
Igf1r C A 7: 67,653,596 (GRCm39) Q45K probably benign Het
Klhl8 C T 5: 104,015,392 (GRCm39) V511I probably damaging Het
Loxl3 A T 6: 83,026,507 (GRCm39) M488L probably benign Het
Myo7a G A 7: 97,721,668 (GRCm39) P1221S probably damaging Het
Myom2 A T 8: 15,164,254 (GRCm39) I1050F probably benign Het
Ncapd3 T G 9: 26,959,520 (GRCm39) C319G probably benign Het
Ndufaf5 C A 2: 140,025,894 (GRCm39) T151K possibly damaging Het
Notch3 A T 17: 32,375,329 (GRCm39) D364E possibly damaging Het
Nudt21 G A 8: 94,763,601 (GRCm39) probably benign Het
Or2p2 T C 13: 21,257,343 (GRCm39) I43V probably benign Het
Pkd1l3 T A 8: 110,362,919 (GRCm39) V1060E probably damaging Het
Plxnd1 G C 6: 115,939,768 (GRCm39) P1404A possibly damaging Het
Ret A G 6: 118,152,770 (GRCm39) V523A possibly damaging Het
Ror1 T C 4: 100,299,084 (GRCm39) I819T possibly damaging Het
Scn10a T A 9: 119,467,840 (GRCm39) K767* probably null Het
Sema5a T A 15: 32,618,989 (GRCm39) W506R probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Sult1b1 C A 5: 87,681,838 (GRCm39) V67F possibly damaging Het
Suz12 T A 11: 79,889,904 (GRCm39) D13E probably damaging Het
Tap1 C T 17: 34,408,409 (GRCm39) A216V probably benign Het
Tlr3 A G 8: 45,851,553 (GRCm39) L448P probably damaging Het
Tnik G A 3: 28,596,152 (GRCm39) V182M probably damaging Het
Ttn A G 2: 76,736,778 (GRCm39) F4329L probably benign Het
Usp21 C T 1: 171,111,246 (GRCm39) E396K probably damaging Het
Vmn1r122 A T 7: 20,867,281 (GRCm39) I258N possibly damaging Het
Vmn2r106 C A 17: 20,499,271 (GRCm39) R213S probably benign Het
Vmn2r111 A T 17: 22,790,274 (GRCm39) M244K probably benign Het
Zeb1 T A 18: 5,748,784 (GRCm39) V117D probably damaging Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
BB015:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1749:Cntrob UTSW 11 69,213,700 (GRCm39) missense probably damaging 0.99
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69,198,880 (GRCm39) missense probably benign 0.27
R1967:Cntrob UTSW 11 69,211,789 (GRCm39) missense probably damaging 0.97
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3121:Cntrob UTSW 11 69,213,526 (GRCm39) nonsense probably null
R3780:Cntrob UTSW 11 69,193,708 (GRCm39) missense probably damaging 0.97
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R4982:Cntrob UTSW 11 69,202,188 (GRCm39) splice site probably null
R5168:Cntrob UTSW 11 69,190,816 (GRCm39) missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7425:Cntrob UTSW 11 69,205,560 (GRCm39) nonsense probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R7946:Cntrob UTSW 11 69,206,047 (GRCm39) missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69,193,741 (GRCm39) missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9626:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1191:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGGGATCTGAGAACTCTAAGC -3'
(R):5'- TGGGTCTCAAAGTTTTGCCCAG -3'

Sequencing Primer
(F):5'- TCTGAGAACTCTAAGCAGGAGTGTG -3'
(R):5'- AAAGTTTTGCCCAGTCTTGAC -3'
Posted On 2021-01-18