Incidental Mutation 'R8542:Prss40'
ID659394
Institutional Source Beutler Lab
Gene Symbol Prss40
Ensembl Gene ENSMUSG00000037529
Gene Nameprotease, serine 40
SynonymsTesp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8542 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location34543968-34560943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34557886 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 76 (W76R)
Ref Sequence ENSEMBL: ENSMUSP00000140885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047840] [ENSMUST00000115071] [ENSMUST00000190790]
Predicted Effect probably damaging
Transcript: ENSMUST00000047840
AA Change: W194R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045118
Gene: ENSMUSG00000037529
AA Change: W194R

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Tryp_SPc 68 308 1.45e-71 SMART
low complexity region 309 319 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115071
SMART Domains Protein: ENSMUSP00000110723
Gene: ENSMUSG00000037529

DomainStartEndE-ValueType
Tryp_SPc 1 146 8.36e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190790
AA Change: W76R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140885
Gene: ENSMUSG00000037529
AA Change: W76R

DomainStartEndE-ValueType
Tryp_SPc 4 145 2.3e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,657,410 T634A probably benign Het
Abca12 C T 1: 71,309,888 probably null Het
Acsl5 A G 19: 55,291,827 T511A probably damaging Het
Alkbh1 A G 12: 87,431,505 F212S probably damaging Het
Ankrd35 A G 3: 96,682,037 I191V probably damaging Het
Apmap T C 2: 150,586,465 Q254R probably benign Het
Atp10b A G 11: 43,230,381 D957G probably benign Het
Bag6 G A 17: 35,144,358 G725S probably damaging Het
Braf T C 6: 39,627,759 H592R probably benign Het
Cilp A T 9: 65,278,123 D500V probably damaging Het
Col27a1 T A 4: 63,321,425 probably null Het
Defa3 T A 8: 21,288,163 probably null Het
Dst C T 1: 34,192,607 H3272Y possibly damaging Het
Egfl8 A G 17: 34,614,269 C168R probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Gipc3 T A 10: 81,338,221 M240L possibly damaging Het
Gm16486 C A 8: 70,713,871 probably null Het
Gm49368 T C 7: 128,080,261 Y192H probably damaging Het
Gm5737 C A 7: 120,817,914 P194Q probably damaging Het
Ier5l A G 2: 30,472,936 I359T possibly damaging Het
Impg1 C T 9: 80,404,798 E168K probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kctd2 G T 11: 115,429,484 probably benign Het
Kdm5b A T 1: 134,605,774 M534L possibly damaging Het
Kif14 T A 1: 136,468,757 V267D possibly damaging Het
Klra3 A T 6: 130,333,133 probably null Het
Lmod1 T C 1: 135,364,483 F359L possibly damaging Het
Mmp24 A G 2: 155,799,714 E154G probably benign Het
Morc3 G T 16: 93,847,431 probably null Het
Mtus2 A C 5: 148,303,598 K85T probably damaging Het
Ncam1 G T 9: 49,508,598 T806K probably damaging Het
Noc2l A G 4: 156,241,730 T425A probably benign Het
Olfm3 A T 3: 115,122,547 Q376L probably benign Het
Olfr553 A G 7: 102,614,665 V108A probably benign Het
Pax5 A T 4: 44,570,071 Y272N probably damaging Het
Pfkp G T 13: 6,581,521 A166E possibly damaging Het
Pnpt1 C A 11: 29,132,773 probably null Het
Rbms1 A C 2: 60,781,921 V165G probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl3l A G 17: 24,735,780 D369G probably damaging Het
Slc29a3 A G 10: 60,730,622 S111P probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
St6galnac6 T A 2: 32,619,501 I305N probably damaging Het
Tanc2 A G 11: 105,917,008 E1288G probably damaging Het
Tdrd6 T C 17: 43,624,892 E1755G probably damaging Het
Tenm4 A T 7: 96,811,932 D895V probably damaging Het
Tmem190 T A 7: 4,784,158 C120* probably null Het
Tmem209 C A 6: 30,497,238 V318F probably damaging Het
Traf3ip3 T A 1: 193,194,543 I196F probably damaging Het
Trpc4ap G C 2: 155,692,212 P32R unknown Het
Usp20 T G 2: 31,011,624 V467G possibly damaging Het
Vav3 A G 3: 109,503,471 K206R probably damaging Het
Zbtb17 CCCCCACCTCCACAGACCCCA CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA 4: 141,466,828 probably benign Het
Zfp629 C A 7: 127,611,192 E482* probably null Het
Other mutations in Prss40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Prss40 APN 1 34552539 missense probably benign 0.01
IGL01298:Prss40 APN 1 34560766 missense probably benign
IGL01694:Prss40 APN 1 34556097 missense probably benign 0.02
IGL03030:Prss40 APN 1 34558101 missense probably damaging 0.99
IGL03393:Prss40 APN 1 34558101 missense probably damaging 0.99
R0294:Prss40 UTSW 1 34556081 missense possibly damaging 0.58
R1450:Prss40 UTSW 1 34556097 missense probably benign 0.02
R1987:Prss40 UTSW 1 34558014 missense possibly damaging 0.75
R2356:Prss40 UTSW 1 34559903 nonsense probably null
R2395:Prss40 UTSW 1 34559905 missense possibly damaging 0.86
R4042:Prss40 UTSW 1 34560879 nonsense probably null
R4043:Prss40 UTSW 1 34560879 nonsense probably null
R4044:Prss40 UTSW 1 34560879 nonsense probably null
R4232:Prss40 UTSW 1 34560792 missense probably benign 0.07
R5418:Prss40 UTSW 1 34560759 missense probably benign 0.00
R5539:Prss40 UTSW 1 34552679 makesense probably null
R5719:Prss40 UTSW 1 34552517 utr 3 prime probably benign
R6365:Prss40 UTSW 1 34552517 utr 3 prime probably benign
R7002:Prss40 UTSW 1 34552400 splice site probably null
R7366:Prss40 UTSW 1 34559871 nonsense probably null
R7521:Prss40 UTSW 1 34558009 missense probably benign 0.03
R7777:Prss40 UTSW 1 34552765 nonsense probably null
R8138:Prss40 UTSW 1 34557999 missense probably damaging 0.99
R8360:Prss40 UTSW 1 34560795 missense probably benign 0.00
Z1176:Prss40 UTSW 1 34559779 missense possibly damaging 0.85
Z1177:Prss40 UTSW 1 34552586 missense probably benign 0.00
Z1177:Prss40 UTSW 1 34560819 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCACTTAGAGCTCTGGAGTC -3'
(R):5'- TGTCATGCTAGGCTACACCG -3'

Sequencing Primer
(F):5'- TGGAGTCAGAGAGCCTACACTTC -3'
(R):5'- ATGCTAGGCTACACCGACCTG -3'
Posted On2021-01-18