Incidental Mutation 'R8542:Usp20'
ID 659401
Institutional Source Beutler Lab
Gene Symbol Usp20
Ensembl Gene ENSMUSG00000026854
Gene Name ubiquitin specific peptidase 20
Synonyms 1700055M05Rik, Vdu2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8542 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 30982279-31023586 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 31011624 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 467 (V467G)
Ref Sequence ENSEMBL: ENSMUSP00000127388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061544] [ENSMUST00000102849] [ENSMUST00000170476]
AlphaFold Q8C6M1
Predicted Effect probably benign
Transcript: ENSMUST00000061544
SMART Domains Protein: ENSMUSP00000060167
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.2e-18 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 210 2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102849
AA Change: V467G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854
AA Change: V467G

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170476
AA Change: V467G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854
AA Change: V467G

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.4e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 270 1.2e-26 PFAM
Pfam:UCH_1 145 669 6.1e-20 PFAM
Pfam:UCH 324 684 1.6e-31 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,657,410 T634A probably benign Het
Abca12 C T 1: 71,309,888 probably null Het
Acsl5 A G 19: 55,291,827 T511A probably damaging Het
Alkbh1 A G 12: 87,431,505 F212S probably damaging Het
Ankrd35 A G 3: 96,682,037 I191V probably damaging Het
Apmap T C 2: 150,586,465 Q254R probably benign Het
Atp10b A G 11: 43,230,381 D957G probably benign Het
Bag6 G A 17: 35,144,358 G725S probably damaging Het
Braf T C 6: 39,627,759 H592R probably benign Het
Cilp A T 9: 65,278,123 D500V probably damaging Het
Col27a1 T A 4: 63,321,425 probably null Het
Defa3 T A 8: 21,288,163 probably null Het
Dst C T 1: 34,192,607 H3272Y possibly damaging Het
Egfl8 A G 17: 34,614,269 C168R probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Gipc3 T A 10: 81,338,221 M240L possibly damaging Het
Gm16486 C A 8: 70,713,871 probably null Het
Gm49368 T C 7: 128,080,261 Y192H probably damaging Het
Gm5737 C A 7: 120,817,914 P194Q probably damaging Het
Ier5l A G 2: 30,472,936 I359T possibly damaging Het
Impg1 C T 9: 80,404,798 E168K probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kctd2 G T 11: 115,429,484 probably benign Het
Kdm5b A T 1: 134,605,774 M534L possibly damaging Het
Kif14 T A 1: 136,468,757 V267D possibly damaging Het
Klra3 A T 6: 130,333,133 probably null Het
Lmod1 T C 1: 135,364,483 F359L possibly damaging Het
Mmp24 A G 2: 155,799,714 E154G probably benign Het
Morc3 G T 16: 93,847,431 probably null Het
Mtus2 A C 5: 148,303,598 K85T probably damaging Het
Ncam1 G T 9: 49,508,598 T806K probably damaging Het
Noc2l A G 4: 156,241,730 T425A probably benign Het
Olfm3 A T 3: 115,122,547 Q376L probably benign Het
Olfr553 A G 7: 102,614,665 V108A probably benign Het
Pax5 A T 4: 44,570,071 Y272N probably damaging Het
Pfkp G T 13: 6,581,521 A166E possibly damaging Het
Pnpt1 C A 11: 29,132,773 probably null Het
Prss40 A G 1: 34,557,886 W76R probably damaging Het
Rbms1 A C 2: 60,781,921 V165G probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl3l A G 17: 24,735,780 D369G probably damaging Het
Slc29a3 A G 10: 60,730,622 S111P probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
St6galnac6 T A 2: 32,619,501 I305N probably damaging Het
Tanc2 A G 11: 105,917,008 E1288G probably damaging Het
Tdrd6 T C 17: 43,624,892 E1755G probably damaging Het
Tenm4 A T 7: 96,811,932 D895V probably damaging Het
Tmem190 T A 7: 4,784,158 C120* probably null Het
Tmem209 C A 6: 30,497,238 V318F probably damaging Het
Traf3ip3 T A 1: 193,194,543 I196F probably damaging Het
Trpc4ap G C 2: 155,692,212 P32R unknown Het
Vav3 A G 3: 109,503,471 K206R probably damaging Het
Zbtb17 CCCCCACCTCCACAGACCCCA CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA 4: 141,466,828 probably benign Het
Zfp629 C A 7: 127,611,192 E482* probably null Het
Other mutations in Usp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Usp20 APN 2 31004950 missense probably damaging 1.00
IGL01444:Usp20 APN 2 30998789 start codon destroyed probably null 1.00
IGL01601:Usp20 APN 2 31011794 missense probably benign 0.04
IGL01785:Usp20 APN 2 31017163 missense probably benign 0.02
IGL01786:Usp20 APN 2 31017163 missense probably benign 0.02
IGL02129:Usp20 APN 2 31004450 missense probably benign 0.43
IGL02147:Usp20 APN 2 31006401 missense probably damaging 1.00
IGL03396:Usp20 APN 2 31011717 missense probably benign
BB007:Usp20 UTSW 2 31010544 missense probably benign 0.21
BB017:Usp20 UTSW 2 31010544 missense probably benign 0.21
PIT4453001:Usp20 UTSW 2 31017486 missense possibly damaging 0.47
R0111:Usp20 UTSW 2 31002612 missense probably damaging 1.00
R0369:Usp20 UTSW 2 31011104 missense probably benign 0.00
R0479:Usp20 UTSW 2 31017475 missense probably benign 0.18
R0538:Usp20 UTSW 2 31004450 missense probably damaging 0.99
R1023:Usp20 UTSW 2 31007813 missense probably damaging 1.00
R1183:Usp20 UTSW 2 31011785 missense probably benign 0.17
R1635:Usp20 UTSW 2 31018818 missense probably benign 0.03
R2114:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2115:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2116:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2117:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2232:Usp20 UTSW 2 31018738 missense probably benign 0.13
R2244:Usp20 UTSW 2 31010331 missense possibly damaging 0.65
R2883:Usp20 UTSW 2 31018800 missense probably benign
R4734:Usp20 UTSW 2 31019824 missense probably benign 0.31
R5507:Usp20 UTSW 2 31010226 missense probably benign
R5770:Usp20 UTSW 2 31017508 missense probably damaging 1.00
R5862:Usp20 UTSW 2 31006449 nonsense probably null
R6315:Usp20 UTSW 2 31017758 missense possibly damaging 0.70
R7603:Usp20 UTSW 2 31011474 missense probably damaging 1.00
R7887:Usp20 UTSW 2 31020894 missense probably benign 0.34
R7930:Usp20 UTSW 2 31010544 missense probably benign 0.21
R8965:Usp20 UTSW 2 31011785 missense possibly damaging 0.77
R9079:Usp20 UTSW 2 31005108 intron probably benign
R9226:Usp20 UTSW 2 31017400 missense probably damaging 0.99
R9417:Usp20 UTSW 2 30983018 critical splice acceptor site probably null
R9459:Usp20 UTSW 2 31011012 missense probably damaging 0.99
Z1176:Usp20 UTSW 2 31019818 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGACGTCTTCAATGGCTCTGTC -3'
(R):5'- TACTGTAGACCCGGGAAAACC -3'

Sequencing Primer
(F):5'- AATGGCTCTGTCCTCAGCCTG -3'
(R):5'- ATGGGCATACCGTCTGATGTACTC -3'
Posted On 2021-01-18