Incidental Mutation 'R8542:Apmap'
ID659404
Institutional Source Beutler Lab
Gene Symbol Apmap
Ensembl Gene ENSMUSG00000033096
Gene Nameadipocyte plasma membrane associated protein
Synonyms2310001A20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8542 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location150583080-150608567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150586465 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 254 (Q254R)
Ref Sequence ENSEMBL: ENSMUSP00000040840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046399]
Predicted Effect probably benign
Transcript: ENSMUST00000046399
AA Change: Q254R

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000040840
Gene: ENSMUSG00000033096
AA Change: Q254R

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Pfam:SGL 101 327 1.4e-17 PFAM
Pfam:Str_synth 200 288 1.2e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,657,410 T634A probably benign Het
Abca12 C T 1: 71,309,888 probably null Het
Acsl5 A G 19: 55,291,827 T511A probably damaging Het
Alkbh1 A G 12: 87,431,505 F212S probably damaging Het
Ankrd35 A G 3: 96,682,037 I191V probably damaging Het
Atp10b A G 11: 43,230,381 D957G probably benign Het
Bag6 G A 17: 35,144,358 G725S probably damaging Het
Braf T C 6: 39,627,759 H592R probably benign Het
Cilp A T 9: 65,278,123 D500V probably damaging Het
Col27a1 T A 4: 63,321,425 probably null Het
Defa3 T A 8: 21,288,163 probably null Het
Dst C T 1: 34,192,607 H3272Y possibly damaging Het
Egfl8 A G 17: 34,614,269 C168R probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Gipc3 T A 10: 81,338,221 M240L possibly damaging Het
Gm16486 C A 8: 70,713,871 probably null Het
Gm49368 T C 7: 128,080,261 Y192H probably damaging Het
Gm5737 C A 7: 120,817,914 P194Q probably damaging Het
Ier5l A G 2: 30,472,936 I359T possibly damaging Het
Impg1 C T 9: 80,404,798 E168K probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kctd2 G T 11: 115,429,484 probably benign Het
Kdm5b A T 1: 134,605,774 M534L possibly damaging Het
Kif14 T A 1: 136,468,757 V267D possibly damaging Het
Klra3 A T 6: 130,333,133 probably null Het
Lmod1 T C 1: 135,364,483 F359L possibly damaging Het
Mmp24 A G 2: 155,799,714 E154G probably benign Het
Morc3 G T 16: 93,847,431 probably null Het
Mtus2 A C 5: 148,303,598 K85T probably damaging Het
Ncam1 G T 9: 49,508,598 T806K probably damaging Het
Noc2l A G 4: 156,241,730 T425A probably benign Het
Olfm3 A T 3: 115,122,547 Q376L probably benign Het
Olfr553 A G 7: 102,614,665 V108A probably benign Het
Pax5 A T 4: 44,570,071 Y272N probably damaging Het
Pfkp G T 13: 6,581,521 A166E possibly damaging Het
Pnpt1 C A 11: 29,132,773 probably null Het
Prss40 A G 1: 34,557,886 W76R probably damaging Het
Rbms1 A C 2: 60,781,921 V165G probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl3l A G 17: 24,735,780 D369G probably damaging Het
Slc29a3 A G 10: 60,730,622 S111P probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
St6galnac6 T A 2: 32,619,501 I305N probably damaging Het
Tanc2 A G 11: 105,917,008 E1288G probably damaging Het
Tdrd6 T C 17: 43,624,892 E1755G probably damaging Het
Tenm4 A T 7: 96,811,932 D895V probably damaging Het
Tmem190 T A 7: 4,784,158 C120* probably null Het
Tmem209 C A 6: 30,497,238 V318F probably damaging Het
Traf3ip3 T A 1: 193,194,543 I196F probably damaging Het
Trpc4ap G C 2: 155,692,212 P32R unknown Het
Usp20 T G 2: 31,011,624 V467G possibly damaging Het
Vav3 A G 3: 109,503,471 K206R probably damaging Het
Zbtb17 CCCCCACCTCCACAGACCCCA CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA 4: 141,466,828 probably benign Het
Zfp629 C A 7: 127,611,192 E482* probably null Het
Other mutations in Apmap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03135:Apmap APN 2 150587115 missense possibly damaging 0.89
R0898:Apmap UTSW 2 150585749 splice site probably benign
R2267:Apmap UTSW 2 150588901 critical splice donor site probably null
R4171:Apmap UTSW 2 150584067 missense probably benign 0.01
R5456:Apmap UTSW 2 150590069 missense probably benign 0.00
R5815:Apmap UTSW 2 150600251 missense probably benign 0.00
R5838:Apmap UTSW 2 150585857 missense probably damaging 1.00
R5846:Apmap UTSW 2 150608421 missense probably damaging 0.99
R6117:Apmap UTSW 2 150600332 missense probably benign 0.13
R6899:Apmap UTSW 2 150594308 missense probably benign 0.07
R8527:Apmap UTSW 2 150586465 missense probably benign 0.21
R8734:Apmap UTSW 2 150588904 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGTGTGAAGCATCTCAGATATC -3'
(R):5'- TGTAGGCTGGGAGAGTCCTTAC -3'

Sequencing Primer
(F):5'- TGAAGCATCTCAGATATCTATTCACC -3'
(R):5'- AGAGTCCTTACTGGCCAGC -3'
Posted On2021-01-18