Incidental Mutation 'R8543:Trmt44'
ID 659464
Institutional Source Beutler Lab
Gene Symbol Trmt44
Ensembl Gene ENSMUSG00000029097
Gene Name tRNA methyltransferase 44
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8543 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 35556203-35575070 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35575030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 6 (R6G)
Ref Sequence ENSEMBL: ENSMUSP00000030980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030980]
AlphaFold Q9D2Q2
Predicted Effect probably benign
Transcript: ENSMUST00000030980
AA Change: R6G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030980
Gene: ENSMUSG00000029097
AA Change: R6G

DomainStartEndE-ValueType
Pfam:AdoMet_MTase 252 363 3.1e-42 PFAM
low complexity region 524 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128195
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative tRNA methyltransferase found in the cytoplasm. Defects in this gene may be a cause of partial epilepsy with pericentral spikes (PEPS), but that has not been proven definitively. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 T A 17: 43,313,206 L839Q probably null Het
Ampd1 T A 3: 103,079,170 F55Y possibly damaging Het
Ank3 A G 10: 70,002,436 E891G probably damaging Het
Ankrd13c A G 3: 158,004,075 probably null Het
Ankrd63 A G 2: 118,703,123 probably benign Het
Arhgap30 T C 1: 171,404,962 S392P probably damaging Het
Arhgef11 A T 3: 87,681,874 K16M probably damaging Het
Birc6 T C 17: 74,565,865 V373A probably damaging Het
Blm A G 7: 80,494,216 M822T probably damaging Het
Car15 T C 16: 17,836,849 N102D probably benign Het
Cdk14 A T 5: 5,380,079 M16K probably benign Het
Cep350 A G 1: 155,862,376 Y2574H probably damaging Het
Coro1a C A 7: 126,702,016 C104F probably damaging Het
D130043K22Rik T A 13: 24,889,869 L977Q probably benign Het
Dcaf1 T G 9: 106,858,078 S742A probably benign Het
Dnajb11 A T 16: 22,862,585 I38L probably benign Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fat4 A C 3: 38,977,494 H2476P probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gm14326 G A 2: 177,945,659 R515W probably damaging Het
Gm49368 T C 7: 128,080,261 Y192H probably damaging Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gpr182 T C 10: 127,750,992 H30R probably benign Het
Gprc5c T A 11: 114,864,268 V257E probably damaging Het
Iars2 T C 1: 185,287,144 T982A probably benign Het
Ighg2b C A 12: 113,306,932 A193S probably damaging Het
Izumo1 T A 7: 45,626,254 V329E possibly damaging Het
Kcnj6 A T 16: 94,762,391 V398E possibly damaging Het
Lef1 T A 3: 131,115,489 N117K possibly damaging Het
Ltbp4 T C 7: 27,325,241 S655G possibly damaging Het
Magi3 A T 3: 104,219,668 I100N probably damaging Het
Mettl17 G A 14: 51,888,800 A222T probably benign Het
Notch4 A G 17: 34,568,420 E318G probably damaging Het
Nqo2 A T 13: 33,985,314 probably null Het
Olfr1077-ps1 A T 2: 86,526,042 M45K probably damaging Het
Ptpn18 T C 1: 34,472,148 S324P probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rin1 A G 19: 5,052,072 D203G probably damaging Het
Serpinb9c T A 13: 33,156,434 E128V probably damaging Het
Slc3a1 C A 17: 85,028,497 N22K probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tmco4 G T 4: 139,053,940 V472L probably benign Het
Tmem132d T C 5: 128,268,735 E241G probably benign Het
Trim17 T A 11: 58,971,455 S438T probably damaging Het
Vcl G T 14: 20,995,059 L277F probably benign Het
Vmn2r68 C T 7: 85,234,440 M152I probably benign Het
Vmn2r94 C T 17: 18,243,722 V769I possibly damaging Het
Vps13d G T 4: 145,016,783 S3027* probably null Het
Zfp282 A G 6: 47,904,627 Q416R probably benign Het
Zfp668 A G 7: 127,867,220 L264P probably damaging Het
Zfp747 A G 7: 127,374,483 Y172H probably damaging Het
Other mutations in Trmt44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Trmt44 APN 5 35568803 missense possibly damaging 0.61
IGL02139:Trmt44 APN 5 35568799 nonsense probably null
IGL02223:Trmt44 APN 5 35574645 missense probably benign 0.00
IGL02273:Trmt44 APN 5 35574113 missense probably damaging 1.00
IGL02667:Trmt44 APN 5 35571052 missense probably damaging 1.00
IGL03144:Trmt44 APN 5 35564422 missense probably benign 0.27
R0207:Trmt44 UTSW 5 35572917 missense possibly damaging 0.95
R0540:Trmt44 UTSW 5 35568759 critical splice donor site probably null
R0607:Trmt44 UTSW 5 35568759 critical splice donor site probably null
R1681:Trmt44 UTSW 5 35569977 missense probably benign 0.13
R1746:Trmt44 UTSW 5 35564059 missense probably benign 0.00
R2128:Trmt44 UTSW 5 35574832 missense probably benign 0.05
R4190:Trmt44 UTSW 5 35574970 missense possibly damaging 0.60
R4611:Trmt44 UTSW 5 35575007 missense probably benign 0.13
R4684:Trmt44 UTSW 5 35558043 missense probably benign 0.07
R5114:Trmt44 UTSW 5 35565468 missense possibly damaging 0.67
R5951:Trmt44 UTSW 5 35572688 unclassified probably benign
R6125:Trmt44 UTSW 5 35565498 missense probably damaging 1.00
R7131:Trmt44 UTSW 5 35571066 missense probably damaging 1.00
R7239:Trmt44 UTSW 5 35574786 missense probably benign 0.00
R7265:Trmt44 UTSW 5 35564303 missense probably benign 0.13
R7561:Trmt44 UTSW 5 35557992 missense possibly damaging 0.47
R8552:Trmt44 UTSW 5 35565400 missense probably benign 0.04
R8560:Trmt44 UTSW 5 35557951 missense probably benign 0.00
R8850:Trmt44 UTSW 5 35564329 missense probably benign 0.02
R9209:Trmt44 UTSW 5 35574078 critical splice donor site probably null
R9330:Trmt44 UTSW 5 35569920 missense probably damaging 1.00
R9588:Trmt44 UTSW 5 35569912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCATAGCGAGTTCAGGTC -3'
(R):5'- ATTCAGTCGTTGAGGACCCC -3'

Sequencing Primer
(F):5'- ATAGCGAGTTCAGGTCAGCCG -3'
(R):5'- AGGAGGCTGTATCCACTGC -3'
Posted On 2021-01-18