Incidental Mutation 'R8543:Blm'
ID 659470
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene Name Bloom syndrome, RecQ like helicase
Synonyms
MMRRC Submission 068508-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8543 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80104741-80184896 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80143964 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 822 (M822T)
Ref Sequence ENSEMBL: ENSMUSP00000080062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
AlphaFold O88700
Predicted Effect probably damaging
Transcript: ENSMUST00000081314
AA Change: M822T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: M822T

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170315
AA Change: M825T

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: M825T

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Meta Mutation Damage Score 0.4198 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 T A 17: 43,624,097 (GRCm39) L839Q probably null Het
Ampd1 T A 3: 102,986,486 (GRCm39) F55Y possibly damaging Het
Ank3 A G 10: 69,838,266 (GRCm39) E891G probably damaging Het
Ankrd13c A G 3: 157,709,712 (GRCm39) probably null Het
Ankrd63 A G 2: 118,533,604 (GRCm39) probably benign Het
Arhgap30 T C 1: 171,232,530 (GRCm39) S392P probably damaging Het
Arhgef11 A T 3: 87,589,181 (GRCm39) K16M probably damaging Het
Birc6 T C 17: 74,872,860 (GRCm39) V373A probably damaging Het
Car15 T C 16: 17,654,713 (GRCm39) N102D probably benign Het
Cdk14 A T 5: 5,430,079 (GRCm39) M16K probably benign Het
Cep350 A G 1: 155,738,122 (GRCm39) Y2574H probably damaging Het
Coro1a C A 7: 126,301,188 (GRCm39) C104F probably damaging Het
D130043K22Rik T A 13: 25,073,852 (GRCm39) L977Q probably benign Het
Dcaf1 T G 9: 106,735,277 (GRCm39) S742A probably benign Het
Dnajb11 A T 16: 22,681,335 (GRCm39) I38L probably benign Het
Eppk1 C T 15: 75,994,319 (GRCm39) R854Q probably benign Het
Fat4 A C 3: 39,031,643 (GRCm39) H2476P probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Gm14326 G A 2: 177,587,452 (GRCm39) R515W probably damaging Het
Gm49368 T C 7: 127,679,433 (GRCm39) Y192H probably damaging Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 141,765,782 (GRCm39) probably benign Het
Gpr182 T C 10: 127,586,861 (GRCm39) H30R probably benign Het
Gprc5c T A 11: 114,755,094 (GRCm39) V257E probably damaging Het
Iars2 T C 1: 185,019,341 (GRCm39) T982A probably benign Het
Ighg2b C A 12: 113,270,552 (GRCm39) A193S probably damaging Het
Izumo1 T A 7: 45,275,678 (GRCm39) V329E possibly damaging Het
Kcnj6 A T 16: 94,563,250 (GRCm39) V398E possibly damaging Het
Lef1 T A 3: 130,909,138 (GRCm39) N117K possibly damaging Het
Ltbp4 T C 7: 27,024,666 (GRCm39) S655G possibly damaging Het
Magi3 A T 3: 104,126,984 (GRCm39) I100N probably damaging Het
Mettl17 G A 14: 52,126,257 (GRCm39) A222T probably benign Het
Notch4 A G 17: 34,787,394 (GRCm39) E318G probably damaging Het
Nqo2 A T 13: 34,169,297 (GRCm39) probably null Het
Or8k31-ps1 A T 2: 86,356,386 (GRCm39) M45K probably damaging Het
Ptpn18 T C 1: 34,511,229 (GRCm39) S324P probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rin1 A G 19: 5,102,100 (GRCm39) D203G probably damaging Het
Serpinb9c T A 13: 33,340,417 (GRCm39) E128V probably damaging Het
Slc3a1 C A 17: 85,335,925 (GRCm39) N22K probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Tmco4 G T 4: 138,781,251 (GRCm39) V472L probably benign Het
Tmem132d T C 5: 128,345,799 (GRCm39) E241G probably benign Het
Trim17 T A 11: 58,862,281 (GRCm39) S438T probably damaging Het
Trmt44 T C 5: 35,732,374 (GRCm39) R6G probably benign Het
Vcl G T 14: 21,045,127 (GRCm39) L277F probably benign Het
Vmn2r68 C T 7: 84,883,648 (GRCm39) M152I probably benign Het
Vmn2r94 C T 17: 18,463,984 (GRCm39) V769I possibly damaging Het
Vps13d G T 4: 144,743,353 (GRCm39) S3027* probably null Het
Zfp282 A G 6: 47,881,561 (GRCm39) Q416R probably benign Het
Zfp668 A G 7: 127,466,392 (GRCm39) L264P probably damaging Het
Zfp747 A G 7: 126,973,655 (GRCm39) Y172H probably damaging Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80,123,819 (GRCm39) missense probably damaging 1.00
IGL01658:Blm APN 7 80,113,689 (GRCm39) missense probably damaging 0.98
IGL02048:Blm APN 7 80,152,709 (GRCm39) splice site probably benign
IGL02060:Blm APN 7 80,164,328 (GRCm39) splice site probably benign
IGL02063:Blm APN 7 80,159,167 (GRCm39) nonsense probably null
IGL02102:Blm APN 7 80,119,504 (GRCm39) missense probably damaging 1.00
IGL02420:Blm APN 7 80,145,754 (GRCm39) missense probably damaging 1.00
IGL02452:Blm APN 7 80,153,125 (GRCm39) splice site probably null
IGL02566:Blm APN 7 80,123,944 (GRCm39) missense probably damaging 1.00
IGL03387:Blm APN 7 80,143,895 (GRCm39) missense probably damaging 1.00
FR4304:Blm UTSW 7 80,162,667 (GRCm39) small insertion probably benign
FR4304:Blm UTSW 7 80,113,521 (GRCm39) frame shift probably null
FR4340:Blm UTSW 7 80,162,658 (GRCm39) small insertion probably benign
FR4340:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
FR4340:Blm UTSW 7 80,113,515 (GRCm39) unclassified probably benign
FR4449:Blm UTSW 7 80,162,656 (GRCm39) small insertion probably benign
FR4548:Blm UTSW 7 80,113,517 (GRCm39) frame shift probably null
FR4589:Blm UTSW 7 80,113,518 (GRCm39) frame shift probably null
FR4737:Blm UTSW 7 80,113,522 (GRCm39) frame shift probably null
FR4737:Blm UTSW 7 80,113,519 (GRCm39) frame shift probably null
FR4976:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
FR4976:Blm UTSW 7 80,113,515 (GRCm39) unclassified probably benign
R0133:Blm UTSW 7 80,152,115 (GRCm39) missense possibly damaging 0.93
R0194:Blm UTSW 7 80,114,694 (GRCm39) unclassified probably benign
R0526:Blm UTSW 7 80,155,641 (GRCm39) nonsense probably null
R0673:Blm UTSW 7 80,149,499 (GRCm39) critical splice donor site probably null
R0972:Blm UTSW 7 80,163,118 (GRCm39) missense probably benign
R0980:Blm UTSW 7 80,149,706 (GRCm39) splice site probably null
R1120:Blm UTSW 7 80,131,214 (GRCm39) missense probably damaging 1.00
R1301:Blm UTSW 7 80,105,165 (GRCm39) nonsense probably null
R1769:Blm UTSW 7 80,163,118 (GRCm39) missense probably benign
R1866:Blm UTSW 7 80,143,862 (GRCm39) missense probably benign 0.08
R1874:Blm UTSW 7 80,147,166 (GRCm39) missense probably damaging 1.00
R1966:Blm UTSW 7 80,162,934 (GRCm39) missense possibly damaging 0.86
R1991:Blm UTSW 7 80,155,697 (GRCm39) splice site probably null
R2013:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2014:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2015:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2016:Blm UTSW 7 80,155,674 (GRCm39) missense probably benign 0.26
R2103:Blm UTSW 7 80,155,697 (GRCm39) splice site probably null
R2161:Blm UTSW 7 80,131,118 (GRCm39) splice site probably null
R2215:Blm UTSW 7 80,149,595 (GRCm39) missense possibly damaging 0.69
R3689:Blm UTSW 7 80,162,827 (GRCm39) missense possibly damaging 0.56
R4049:Blm UTSW 7 80,152,610 (GRCm39) missense probably benign 0.04
R4155:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R4695:Blm UTSW 7 80,143,976 (GRCm39) missense probably damaging 1.00
R4774:Blm UTSW 7 80,113,596 (GRCm39) missense probably damaging 1.00
R4833:Blm UTSW 7 80,116,574 (GRCm39) missense probably benign
R4835:Blm UTSW 7 80,159,294 (GRCm39) missense probably benign 0.41
R4994:Blm UTSW 7 80,108,573 (GRCm39) missense probably benign 0.00
R5039:Blm UTSW 7 80,155,621 (GRCm39) missense possibly damaging 0.50
R5330:Blm UTSW 7 80,108,684 (GRCm39) missense possibly damaging 0.73
R5375:Blm UTSW 7 80,162,977 (GRCm39) missense probably benign 0.00
R5408:Blm UTSW 7 80,152,370 (GRCm39) missense probably benign 0.01
R5574:Blm UTSW 7 80,149,521 (GRCm39) missense probably damaging 1.00
R5606:Blm UTSW 7 80,110,580 (GRCm39) splice site probably null
R5702:Blm UTSW 7 80,108,675 (GRCm39) missense probably benign 0.13
R5809:Blm UTSW 7 80,114,592 (GRCm39) missense probably damaging 1.00
R6114:Blm UTSW 7 80,163,235 (GRCm39) missense probably damaging 1.00
R6157:Blm UTSW 7 80,162,733 (GRCm39) missense probably benign 0.18
R6163:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R6254:Blm UTSW 7 80,130,090 (GRCm39) missense probably benign 0.04
R6266:Blm UTSW 7 80,149,688 (GRCm39) missense probably benign 0.03
R6364:Blm UTSW 7 80,144,274 (GRCm39) nonsense probably null
R6446:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R6502:Blm UTSW 7 80,131,223 (GRCm39) missense probably damaging 0.98
R6700:Blm UTSW 7 80,113,598 (GRCm39) missense possibly damaging 0.91
R7002:Blm UTSW 7 80,119,501 (GRCm39) missense probably benign 0.00
R7105:Blm UTSW 7 80,149,516 (GRCm39) missense probably benign 0.44
R7320:Blm UTSW 7 80,105,102 (GRCm39) nonsense probably null
R7465:Blm UTSW 7 80,162,863 (GRCm39) missense probably benign 0.02
R7561:Blm UTSW 7 80,152,276 (GRCm39) missense probably damaging 0.99
R8500:Blm UTSW 7 80,105,032 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
R8774-TAIL:Blm UTSW 7 80,162,666 (GRCm39) small insertion probably benign
R8774-TAIL:Blm UTSW 7 80,162,667 (GRCm39) small insertion probably benign
R8775-TAIL:Blm UTSW 7 80,162,679 (GRCm39) small insertion probably benign
R8860:Blm UTSW 7 80,144,276 (GRCm39) missense probably benign 0.30
R8928:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R9089:Blm UTSW 7 80,162,867 (GRCm39) missense probably damaging 1.00
R9363:Blm UTSW 7 80,108,663 (GRCm39) missense probably damaging 1.00
RF001:Blm UTSW 7 80,162,675 (GRCm39) small insertion probably benign
RF001:Blm UTSW 7 80,162,654 (GRCm39) small insertion probably benign
RF001:Blm UTSW 7 80,162,651 (GRCm39) small insertion probably benign
RF002:Blm UTSW 7 80,162,675 (GRCm39) small insertion probably benign
RF002:Blm UTSW 7 80,162,653 (GRCm39) small insertion probably benign
RF007:Blm UTSW 7 80,162,681 (GRCm39) nonsense probably null
RF016:Blm UTSW 7 80,162,674 (GRCm39) nonsense probably null
RF018:Blm UTSW 7 80,162,674 (GRCm39) nonsense probably null
RF027:Blm UTSW 7 80,162,662 (GRCm39) frame shift probably null
RF028:Blm UTSW 7 80,162,653 (GRCm39) nonsense probably null
RF031:Blm UTSW 7 80,162,671 (GRCm39) small insertion probably benign
RF031:Blm UTSW 7 80,162,654 (GRCm39) small insertion probably benign
RF032:Blm UTSW 7 80,162,678 (GRCm39) small insertion probably benign
RF036:Blm UTSW 7 80,162,662 (GRCm39) nonsense probably null
RF044:Blm UTSW 7 80,162,678 (GRCm39) small insertion probably benign
RF053:Blm UTSW 7 80,162,669 (GRCm39) small insertion probably benign
RF064:Blm UTSW 7 80,162,671 (GRCm39) nonsense probably null
X0061:Blm UTSW 7 80,108,598 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTTCCCAAATTTTACTGCACTGAG -3'
(R):5'- TACCACCAGTAGTGCTCAGAGC -3'

Sequencing Primer
(F):5'- CTTGATAAAGCCCTACAGGTGATGC -3'
(R):5'- CAGTAGTGCTCAGAGCCACAG -3'
Posted On 2021-01-18