Incidental Mutation 'R8543:Vmn2r68'
ID 659471
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Name vomeronasal 2, receptor 68
Synonyms Vmn2r68-ps, EG620697
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R8543 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 85221518-85237704 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 85234440 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 152 (M152I)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
AlphaFold L7N2B3
Predicted Effect probably benign
Transcript: ENSMUST00000061074
AA Change: M152I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: M152I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 T A 17: 43,313,206 L839Q probably null Het
Ampd1 T A 3: 103,079,170 F55Y possibly damaging Het
Ank3 A G 10: 70,002,436 E891G probably damaging Het
Ankrd13c A G 3: 158,004,075 probably null Het
Ankrd63 A G 2: 118,703,123 probably benign Het
Arhgap30 T C 1: 171,404,962 S392P probably damaging Het
Arhgef11 A T 3: 87,681,874 K16M probably damaging Het
Birc6 T C 17: 74,565,865 V373A probably damaging Het
Blm A G 7: 80,494,216 M822T probably damaging Het
Car15 T C 16: 17,836,849 N102D probably benign Het
Cdk14 A T 5: 5,380,079 M16K probably benign Het
Cep350 A G 1: 155,862,376 Y2574H probably damaging Het
Coro1a C A 7: 126,702,016 C104F probably damaging Het
D130043K22Rik T A 13: 24,889,869 L977Q probably benign Het
Dcaf1 T G 9: 106,858,078 S742A probably benign Het
Dnajb11 A T 16: 22,862,585 I38L probably benign Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fat4 A C 3: 38,977,494 H2476P probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gm14326 G A 2: 177,945,659 R515W probably damaging Het
Gm49368 T C 7: 128,080,261 Y192H probably damaging Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gpr182 T C 10: 127,750,992 H30R probably benign Het
Gprc5c T A 11: 114,864,268 V257E probably damaging Het
Iars2 T C 1: 185,287,144 T982A probably benign Het
Ighg2b C A 12: 113,306,932 A193S probably damaging Het
Izumo1 T A 7: 45,626,254 V329E possibly damaging Het
Kcnj6 A T 16: 94,762,391 V398E possibly damaging Het
Lef1 T A 3: 131,115,489 N117K possibly damaging Het
Ltbp4 T C 7: 27,325,241 S655G possibly damaging Het
Magi3 A T 3: 104,219,668 I100N probably damaging Het
Mettl17 G A 14: 51,888,800 A222T probably benign Het
Notch4 A G 17: 34,568,420 E318G probably damaging Het
Nqo2 A T 13: 33,985,314 probably null Het
Olfr1077-ps1 A T 2: 86,526,042 M45K probably damaging Het
Ptpn18 T C 1: 34,472,148 S324P probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rin1 A G 19: 5,052,072 D203G probably damaging Het
Serpinb9c T A 13: 33,156,434 E128V probably damaging Het
Slc3a1 C A 17: 85,028,497 N22K probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tmco4 G T 4: 139,053,940 V472L probably benign Het
Tmem132d T C 5: 128,268,735 E241G probably benign Het
Trim17 T A 11: 58,971,455 S438T probably damaging Het
Trmt44 T C 5: 35,575,030 R6G probably benign Het
Vcl G T 14: 20,995,059 L277F probably benign Het
Vmn2r94 C T 17: 18,243,722 V769I possibly damaging Het
Vps13d G T 4: 145,016,783 S3027* probably null Het
Zfp282 A G 6: 47,904,627 Q416R probably benign Het
Zfp668 A G 7: 127,867,220 L264P probably damaging Het
Zfp747 A G 7: 127,374,483 Y172H probably damaging Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 85237611 missense probably benign
IGL01477:Vmn2r68 APN 7 85233483 missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 85222260 missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 85222117 missense probably benign
IGL01999:Vmn2r68 APN 7 85222231 missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 85221739 missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 85221945 nonsense probably null
IGL02827:Vmn2r68 APN 7 85237592 missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 85233387 missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 85234441 missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 85222240 nonsense probably null
IGL03166:Vmn2r68 APN 7 85222123 missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 85221764 missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 85233755 missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0280:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0281:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0348:Vmn2r68 UTSW 7 85221676 missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0390:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0722:Vmn2r68 UTSW 7 85221586 missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 85237504 splice site probably null
R1136:Vmn2r68 UTSW 7 85222341 missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 85232492 missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 85221738 missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 85233366 missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 85233678 missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 85234659 nonsense probably null
R1908:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 85233894 missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 85221915 missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2185:Vmn2r68 UTSW 7 85233693 nonsense probably null
R2188:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2282:Vmn2r68 UTSW 7 85221651 missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 85234595 missense probably benign
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 85237667 missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R3978:Vmn2r68 UTSW 7 85232462 missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4421:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4478:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4479:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4495:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4628:Vmn2r68 UTSW 7 85234465 missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 85221535 missense probably benign
R4654:Vmn2r68 UTSW 7 85233561 nonsense probably null
R4793:Vmn2r68 UTSW 7 85234440 missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 85232414 missense probably benign
R5021:Vmn2r68 UTSW 7 85233734 missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 85233868 missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 85221991 missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 85221877 missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 85237559 missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 85233718 missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 85222075 missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 85233770 missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 85237604 missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 85222245 missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 85233840 missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 85221765 missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 85233707 missense probably benign
R6699:Vmn2r68 UTSW 7 85232375 missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 85222252 missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 85233834 missense probably benign
R7374:Vmn2r68 UTSW 7 85232399 missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 85232379 missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 85233908 missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 85234514 missense probably benign
R7979:Vmn2r68 UTSW 7 85234417 critical splice donor site probably null
R8177:Vmn2r68 UTSW 7 85222214 nonsense probably null
R8349:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 85221900 missense probably benign 0.00
R8397:Vmn2r68 UTSW 7 85237514 missense possibly damaging 0.71
R8449:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
R8680:Vmn2r68 UTSW 7 85222113 missense possibly damaging 0.68
R9056:Vmn2r68 UTSW 7 85222212 missense possibly damaging 0.71
R9342:Vmn2r68 UTSW 7 85233785 missense probably benign 0.39
R9734:Vmn2r68 UTSW 7 85233549 missense possibly damaging 0.54
V7581:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 85221733 missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 85222081 missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 85222099 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AATGCTGCTGCCTCCCATAC -3'
(R):5'- CCCAAGACCAACCATTTGATTTTC -3'

Sequencing Primer
(F):5'- GCCTCCCATACCCATTTATGATAAAG -3'
(R):5'- CTCTGTTTATCTTGCCTTGGATG -3'
Posted On 2021-01-18