Incidental Mutation 'R8543:Trim17'
ID 659480
Institutional Source Beutler Lab
Gene Symbol Trim17
Ensembl Gene ENSMUSG00000036964
Gene Name tripartite motif-containing 17
Synonyms terf, Rnf16
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8543 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 58954685-58973098 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58971455 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 438 (S438T)
Ref Sequence ENSEMBL: ENSMUSP00000074639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047697] [ENSMUST00000075141]
AlphaFold Q7TPM3
Predicted Effect probably benign
Transcript: ENSMUST00000047697
SMART Domains Protein: ENSMUSP00000037248
Gene: ENSMUSG00000036964

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075141
AA Change: S438T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074639
Gene: ENSMUSG00000036964
AA Change: S438T

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
PRY 294 347 8.95e-16 SMART
SPRY 348 472 2.54e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein is expressed almost exclusively in the testis, but its function is unknown. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 T A 17: 43,313,206 L839Q probably null Het
Ampd1 T A 3: 103,079,170 F55Y possibly damaging Het
Ank3 A G 10: 70,002,436 E891G probably damaging Het
Ankrd13c A G 3: 158,004,075 probably null Het
Ankrd63 A G 2: 118,703,123 probably benign Het
Arhgap30 T C 1: 171,404,962 S392P probably damaging Het
Arhgef11 A T 3: 87,681,874 K16M probably damaging Het
Birc6 T C 17: 74,565,865 V373A probably damaging Het
Blm A G 7: 80,494,216 M822T probably damaging Het
Car15 T C 16: 17,836,849 N102D probably benign Het
Cdk14 A T 5: 5,380,079 M16K probably benign Het
Cep350 A G 1: 155,862,376 Y2574H probably damaging Het
Coro1a C A 7: 126,702,016 C104F probably damaging Het
D130043K22Rik T A 13: 24,889,869 L977Q probably benign Het
Dcaf1 T G 9: 106,858,078 S742A probably benign Het
Dnajb11 A T 16: 22,862,585 I38L probably benign Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fat4 A C 3: 38,977,494 H2476P probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gm14326 G A 2: 177,945,659 R515W probably damaging Het
Gm49368 T C 7: 128,080,261 Y192H probably damaging Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gpr182 T C 10: 127,750,992 H30R probably benign Het
Gprc5c T A 11: 114,864,268 V257E probably damaging Het
Iars2 T C 1: 185,287,144 T982A probably benign Het
Ighg2b C A 12: 113,306,932 A193S probably damaging Het
Izumo1 T A 7: 45,626,254 V329E possibly damaging Het
Kcnj6 A T 16: 94,762,391 V398E possibly damaging Het
Lef1 T A 3: 131,115,489 N117K possibly damaging Het
Ltbp4 T C 7: 27,325,241 S655G possibly damaging Het
Magi3 A T 3: 104,219,668 I100N probably damaging Het
Mettl17 G A 14: 51,888,800 A222T probably benign Het
Notch4 A G 17: 34,568,420 E318G probably damaging Het
Nqo2 A T 13: 33,985,314 probably null Het
Olfr1077-ps1 A T 2: 86,526,042 M45K probably damaging Het
Ptpn18 T C 1: 34,472,148 S324P probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rin1 A G 19: 5,052,072 D203G probably damaging Het
Serpinb9c T A 13: 33,156,434 E128V probably damaging Het
Slc3a1 C A 17: 85,028,497 N22K probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tmco4 G T 4: 139,053,940 V472L probably benign Het
Tmem132d T C 5: 128,268,735 E241G probably benign Het
Trmt44 T C 5: 35,575,030 R6G probably benign Het
Vcl G T 14: 20,995,059 L277F probably benign Het
Vmn2r68 C T 7: 85,234,440 M152I probably benign Het
Vmn2r94 C T 17: 18,243,722 V769I possibly damaging Het
Vps13d G T 4: 145,016,783 S3027* probably null Het
Zfp282 A G 6: 47,904,627 Q416R probably benign Het
Zfp668 A G 7: 127,867,220 L264P probably damaging Het
Zfp747 A G 7: 127,374,483 Y172H probably damaging Het
Other mutations in Trim17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Trim17 APN 11 58970597 missense probably damaging 1.00
IGL02581:Trim17 APN 11 58971076 nonsense probably null
P0026:Trim17 UTSW 11 58971258 missense possibly damaging 0.83
R0518:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R0521:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R0765:Trim17 UTSW 11 58971369 missense possibly damaging 0.73
R1165:Trim17 UTSW 11 58971215 missense possibly damaging 0.92
R1441:Trim17 UTSW 11 58965192 missense probably damaging 1.00
R2164:Trim17 UTSW 11 58971411 missense probably damaging 1.00
R2320:Trim17 UTSW 11 58966798 missense probably benign
R3436:Trim17 UTSW 11 58965233 missense probably damaging 1.00
R4715:Trim17 UTSW 11 58968450 intron probably benign
R4832:Trim17 UTSW 11 58971444 missense probably damaging 0.97
R4928:Trim17 UTSW 11 58954301 unclassified probably benign
R4950:Trim17 UTSW 11 58970428 missense probably damaging 0.98
R5339:Trim17 UTSW 11 58954510 splice site probably null
R5909:Trim17 UTSW 11 58968680 missense probably damaging 1.00
R5915:Trim17 UTSW 11 58968562 missense probably damaging 0.99
R5947:Trim17 UTSW 11 58965543 missense probably damaging 1.00
R6732:Trim17 UTSW 11 58971025 critical splice acceptor site probably null
R7027:Trim17 UTSW 11 58968616 missense probably benign 0.08
R7143:Trim17 UTSW 11 58965184 nonsense probably null
R7168:Trim17 UTSW 11 58968578 missense probably benign
R7682:Trim17 UTSW 11 58966808 missense possibly damaging 0.82
R7707:Trim17 UTSW 11 58965284 nonsense probably null
R7972:Trim17 UTSW 11 58968568 missense probably benign 0.01
R8791:Trim17 UTSW 11 58971176 missense probably benign 0.00
R8894:Trim17 UTSW 11 58968710 missense probably benign 0.00
R9015:Trim17 UTSW 11 58965231 missense probably damaging 0.99
R9026:Trim17 UTSW 11 58971447 missense probably benign 0.01
R9269:Trim17 UTSW 11 58971431 missense probably damaging 1.00
R9609:Trim17 UTSW 11 58965138 missense probably damaging 1.00
Z1177:Trim17 UTSW 11 58965389 missense probably damaging 0.99
Z1186:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1186:Trim17 UTSW 11 58970446 missense probably benign
Z1187:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1187:Trim17 UTSW 11 58970446 missense probably benign
Z1188:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1188:Trim17 UTSW 11 58970446 missense probably benign
Z1189:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1189:Trim17 UTSW 11 58970446 missense probably benign
Z1190:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1190:Trim17 UTSW 11 58970446 missense probably benign
Z1191:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1191:Trim17 UTSW 11 58970446 missense probably benign
Z1192:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1192:Trim17 UTSW 11 58970446 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTAAGTCCCCAGAAAACGG -3'
(R):5'- TTAACTCTTAGTGCCCCAGGG -3'

Sequencing Primer
(F):5'- AAAACGGCTTCTGGGTAGTGC -3'
(R):5'- GTGAAGCACCCTGCCTTCTG -3'
Posted On 2021-01-18