Incidental Mutation 'R8543:D130043K22Rik'
ID 659483
Institutional Source Beutler Lab
Gene Symbol D130043K22Rik
Ensembl Gene ENSMUSG00000006711
Gene Name RIKEN cDNA D130043K22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8543 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 24845135-24901270 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24889869 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 977 (L977Q)
Ref Sequence ENSEMBL: ENSMUSP00000006893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]
AlphaFold Q5SZV5
Predicted Effect probably benign
Transcript: ENSMUST00000006893
AA Change: L977Q

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: L977Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 3e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
FN3 728 808 9.15e1 SMART
PKD 729 820 4.38e-10 SMART
transmembrane domain 965 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141572
SMART Domains Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 2e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 T A 17: 43,313,206 L839Q probably null Het
Ampd1 T A 3: 103,079,170 F55Y possibly damaging Het
Ank3 A G 10: 70,002,436 E891G probably damaging Het
Ankrd13c A G 3: 158,004,075 probably null Het
Ankrd63 A G 2: 118,703,123 probably benign Het
Arhgap30 T C 1: 171,404,962 S392P probably damaging Het
Arhgef11 A T 3: 87,681,874 K16M probably damaging Het
Birc6 T C 17: 74,565,865 V373A probably damaging Het
Blm A G 7: 80,494,216 M822T probably damaging Het
Car15 T C 16: 17,836,849 N102D probably benign Het
Cdk14 A T 5: 5,380,079 M16K probably benign Het
Cep350 A G 1: 155,862,376 Y2574H probably damaging Het
Coro1a C A 7: 126,702,016 C104F probably damaging Het
Dcaf1 T G 9: 106,858,078 S742A probably benign Het
Dnajb11 A T 16: 22,862,585 I38L probably benign Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fat4 A C 3: 38,977,494 H2476P probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gm14326 G A 2: 177,945,659 R515W probably damaging Het
Gm49368 T C 7: 128,080,261 Y192H probably damaging Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gpr182 T C 10: 127,750,992 H30R probably benign Het
Gprc5c T A 11: 114,864,268 V257E probably damaging Het
Iars2 T C 1: 185,287,144 T982A probably benign Het
Ighg2b C A 12: 113,306,932 A193S probably damaging Het
Izumo1 T A 7: 45,626,254 V329E possibly damaging Het
Kcnj6 A T 16: 94,762,391 V398E possibly damaging Het
Lef1 T A 3: 131,115,489 N117K possibly damaging Het
Ltbp4 T C 7: 27,325,241 S655G possibly damaging Het
Magi3 A T 3: 104,219,668 I100N probably damaging Het
Mettl17 G A 14: 51,888,800 A222T probably benign Het
Notch4 A G 17: 34,568,420 E318G probably damaging Het
Nqo2 A T 13: 33,985,314 probably null Het
Olfr1077-ps1 A T 2: 86,526,042 M45K probably damaging Het
Ptpn18 T C 1: 34,472,148 S324P probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rin1 A G 19: 5,052,072 D203G probably damaging Het
Serpinb9c T A 13: 33,156,434 E128V probably damaging Het
Slc3a1 C A 17: 85,028,497 N22K probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tmco4 G T 4: 139,053,940 V472L probably benign Het
Tmem132d T C 5: 128,268,735 E241G probably benign Het
Trim17 T A 11: 58,971,455 S438T probably damaging Het
Trmt44 T C 5: 35,575,030 R6G probably benign Het
Vcl G T 14: 20,995,059 L277F probably benign Het
Vmn2r68 C T 7: 85,234,440 M152I probably benign Het
Vmn2r94 C T 17: 18,243,722 V769I possibly damaging Het
Vps13d G T 4: 145,016,783 S3027* probably null Het
Zfp282 A G 6: 47,904,627 Q416R probably benign Het
Zfp668 A G 7: 127,867,220 L264P probably damaging Het
Zfp747 A G 7: 127,374,483 Y172H probably damaging Het
Other mutations in D130043K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:D130043K22Rik APN 13 24867174 missense probably damaging 1.00
IGL01114:D130043K22Rik APN 13 24857156 missense probably damaging 0.99
IGL01412:D130043K22Rik APN 13 24887860 missense probably damaging 1.00
IGL01542:D130043K22Rik APN 13 24876037 splice site probably null
IGL01615:D130043K22Rik APN 13 24899796 missense probably damaging 1.00
IGL01705:D130043K22Rik APN 13 24857941 missense probably benign 0.00
IGL02220:D130043K22Rik APN 13 24883755 missense possibly damaging 0.95
IGL02229:D130043K22Rik APN 13 24875924 missense probably damaging 1.00
IGL02576:D130043K22Rik APN 13 24856870 missense possibly damaging 0.74
IGL03038:D130043K22Rik APN 13 24879619 missense probably damaging 1.00
IGL03117:D130043K22Rik APN 13 24889842 missense probably damaging 1.00
IGL03014:D130043K22Rik UTSW 13 24858092 missense possibly damaging 0.88
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0020:D130043K22Rik UTSW 13 24854492 utr 5 prime probably benign
R0172:D130043K22Rik UTSW 13 24872406 missense probably benign 0.16
R0276:D130043K22Rik UTSW 13 24858045 missense possibly damaging 0.92
R0304:D130043K22Rik UTSW 13 24864815 missense probably benign 0.07
R0335:D130043K22Rik UTSW 13 24887877 missense probably damaging 0.98
R0744:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0833:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0836:D130043K22Rik UTSW 13 24863580 splice site probably benign
R1270:D130043K22Rik UTSW 13 24857338 missense probably benign 0.00
R1433:D130043K22Rik UTSW 13 24871341 missense probably damaging 1.00
R1682:D130043K22Rik UTSW 13 24882556 missense probably damaging 1.00
R1772:D130043K22Rik UTSW 13 24875999 missense probably damaging 1.00
R1773:D130043K22Rik UTSW 13 24882602 missense possibly damaging 0.80
R1800:D130043K22Rik UTSW 13 24883894 missense probably damaging 1.00
R1956:D130043K22Rik UTSW 13 24885595 missense probably damaging 1.00
R2255:D130043K22Rik UTSW 13 24856911 missense probably damaging 1.00
R2445:D130043K22Rik UTSW 13 24857036 missense probably benign 0.04
R2568:D130043K22Rik UTSW 13 24883891 missense probably damaging 0.97
R4160:D130043K22Rik UTSW 13 24862696 missense probably benign 0.02
R4494:D130043K22Rik UTSW 13 24871356 missense probably benign 0.16
R4732:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4733:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4782:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4799:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4864:D130043K22Rik UTSW 13 24863612 missense probably damaging 1.00
R5155:D130043K22Rik UTSW 13 24872290 missense probably damaging 1.00
R5240:D130043K22Rik UTSW 13 24877977 missense probably damaging 1.00
R5383:D130043K22Rik UTSW 13 24857414 missense probably benign 0.02
R5493:D130043K22Rik UTSW 13 24863603 missense probably damaging 1.00
R6184:D130043K22Rik UTSW 13 24885591 missense probably damaging 1.00
R6305:D130043K22Rik UTSW 13 24885685 missense probably damaging 1.00
R6436:D130043K22Rik UTSW 13 24877935 missense probably damaging 1.00
R6980:D130043K22Rik UTSW 13 24864781 missense probably damaging 0.98
R7038:D130043K22Rik UTSW 13 24893408 missense probably damaging 1.00
R7085:D130043K22Rik UTSW 13 24872302 missense possibly damaging 0.95
R7147:D130043K22Rik UTSW 13 24882563 missense probably benign 0.31
R7384:D130043K22Rik UTSW 13 24882605 missense probably damaging 1.00
R7398:D130043K22Rik UTSW 13 24893377 missense probably damaging 0.97
R7584:D130043K22Rik UTSW 13 24872370 missense probably damaging 1.00
R7585:D130043K22Rik UTSW 13 24885585 missense probably benign 0.01
R7588:D130043K22Rik UTSW 13 24887893 missense probably damaging 0.99
R7610:D130043K22Rik UTSW 13 24876002 missense probably benign 0.30
R7903:D130043K22Rik UTSW 13 24876012 missense probably damaging 0.98
R7966:D130043K22Rik UTSW 13 24893423 missense probably damaging 1.00
R8014:D130043K22Rik UTSW 13 24856702 missense probably damaging 1.00
R8374:D130043K22Rik UTSW 13 24857979 missense probably benign 0.07
R8775:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8775-TAIL:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8806:D130043K22Rik UTSW 13 24899635 missense probably benign 0.11
R8916:D130043K22Rik UTSW 13 24872271 missense probably benign
R9209:D130043K22Rik UTSW 13 24857107 missense possibly damaging 0.96
R9524:D130043K22Rik UTSW 13 24887893 missense possibly damaging 0.89
Z1177:D130043K22Rik UTSW 13 24856709 missense probably damaging 1.00
Z1177:D130043K22Rik UTSW 13 24856834 missense probably benign 0.39
Z1177:D130043K22Rik UTSW 13 24872248 missense possibly damaging 0.79
Z1177:D130043K22Rik UTSW 13 24880847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGAGTTATGTGCCTCATG -3'
(R):5'- CATTGTGCCCATGAAGTCCAG -3'

Sequencing Primer
(F):5'- CCAAACAAAGTCATCAGTTTGCTG -3'
(R):5'- GTCCAGTTTATTTTAAAGCCTCGTTG -3'
Posted On 2021-01-18