Incidental Mutation 'R8544:Olfr1226'
ID659504
Institutional Source Beutler Lab
Gene Symbol Olfr1226
Ensembl Gene ENSMUSG00000075097
Gene Nameolfactory receptor 1226
SynonymsGA_x6K02T2Q125-50672630-50671698, MOR233-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8544 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89188839-89200048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89193968 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 22 (E22G)
Ref Sequence ENSEMBL: ENSMUSP00000151855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099790] [ENSMUST00000214709] [ENSMUST00000215562] [ENSMUST00000215987] [ENSMUST00000216445] [ENSMUST00000217601] [ENSMUST00000220416]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099790
AA Change: E22G

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097378
Gene: ENSMUSG00000075097
AA Change: E22G

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 6.5e-47 PFAM
Pfam:7tm_1 39 285 3.4e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214709
AA Change: E22G

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215562
AA Change: E22G

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215987
AA Change: E22G

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216445
AA Change: E22G

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217601
AA Change: E22G

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220416
AA Change: E22G

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik C A 15: 37,425,735 probably benign Het
A430105I19Rik C T 2: 118,757,221 R544K unknown Het
Abcb5 A T 12: 118,868,726 L1171H probably damaging Het
Ace A T 11: 105,971,290 probably null Het
Adsl G T 15: 80,948,533 probably benign Het
Cabin1 A G 10: 75,750,056 M215T probably benign Het
Cabp2 A T 19: 4,084,892 R77S probably damaging Het
Cast A T 13: 74,734,058 H40Q possibly damaging Het
Ccar1 A T 10: 62,750,579 Y946N unknown Het
Chst14 A G 2: 118,927,529 Y268C probably damaging Het
Dennd1a T C 2: 37,982,908 probably null Het
Dnah1 A G 14: 31,268,904 Y3153H probably damaging Het
Entpd8 T C 2: 25,083,844 V271A probably benign Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fam126b T C 1: 58,529,822 T477A probably benign Het
Fam234b A G 6: 135,233,289 Y561C probably damaging Het
Flg A G 3: 93,288,141 probably benign Het
Galnt5 T A 2: 58,017,148 M541K probably damaging Het
Gjd3 C A 11: 98,982,662 E119* probably null Het
Gm266 T C 12: 111,485,365 T136A possibly damaging Het
Gng11 G A 6: 4,008,045 C36Y possibly damaging Het
Gse1 G A 8: 120,553,652 V36I probably damaging Het
Invs A T 4: 48,397,598 H335L probably damaging Het
Kcnc2 A T 10: 112,456,196 I28F probably damaging Het
Klhl40 C T 9: 121,778,826 H351Y probably damaging Het
Kremen2 A G 17: 23,742,227 L382P probably benign Het
Lenep A T 3: 89,402,477 C55S possibly damaging Het
Lrp12 A T 15: 39,878,574 Y248* probably null Het
Man2c1 A G 9: 57,131,041 probably null Het
Map2k2 T C 10: 81,119,542 M32T possibly damaging Het
Mnt A G 11: 74,831,392 R22G probably damaging Het
Mroh1 G T 15: 76,443,358 E1127* probably null Het
Mtmr4 A G 11: 87,611,909 R930G possibly damaging Het
Nalcn A G 14: 123,371,523 V644A probably benign Het
Ngf G T 3: 102,520,675 V247F probably damaging Het
Ninj2 A G 6: 120,198,057 Y63C probably damaging Het
Olfr577 A T 7: 102,973,731 I87N probably damaging Het
Phf12 A C 11: 78,027,409 I816L probably damaging Het
Pkhd1 C A 1: 20,522,975 G1638V probably damaging Het
Plce1 T A 19: 38,524,459 S67R probably benign Het
Plekhf1 A G 7: 38,221,344 F267L probably damaging Het
Poc1b A T 10: 99,124,908 K60* probably null Het
Ppic G A 18: 53,411,540 T66M probably damaging Het
Prep G T 10: 45,153,127 G541V probably damaging Het
Rasal3 C T 17: 32,392,119 V947I probably benign Het
Rbl1 T C 2: 157,193,204 R319G probably damaging Het
Rbm34 A G 8: 126,970,071 S94P probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Sacm1l T C 9: 123,577,058 probably null Het
Scaf8 T C 17: 3,163,020 probably benign Het
Scrn1 T A 6: 54,522,856 T215S probably benign Het
Sfrp4 A G 13: 19,632,166 probably null Het
Slc37a3 T C 6: 39,344,363 I406V possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sptbn1 C A 11: 30,219,750 probably benign Het
St8sia5 T C 18: 77,254,418 Y275H probably damaging Het
Stab1 A T 14: 31,163,051 C137* probably null Het
Svep1 A G 4: 58,206,025 S118P probably benign Het
Tbx6 A G 7: 126,781,484 probably null Het
Tril C T 6: 53,819,310 S309N possibly damaging Het
Trmt13 A G 3: 116,592,445 probably null Het
Trpm1 T A 7: 64,224,608 probably null Het
Tyr T C 7: 87,492,792 T110A probably benign Het
Upf1 A C 8: 70,337,052 F711C probably damaging Het
Usp5 A T 6: 124,823,517 V267D probably damaging Het
Virma C A 4: 11,516,949 D714E probably benign Het
Vmn2r115 A C 17: 23,345,799 Q220P possibly damaging Het
Vmn2r40 T C 7: 8,908,192 I701V Het
Vwde T A 6: 13,187,653 M612L probably benign Het
Wwox A G 8: 114,488,906 T140A probably benign Het
Zbtb17 CCCCCACCTCCACAGACCCCA CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA 4: 141,466,828 probably benign Het
Zbtb9 T A 17: 26,974,474 C284* probably null Het
Zdhhc12 C A 2: 30,093,474 A39S probably benign Het
Zfp532 T A 18: 65,625,156 I720K possibly damaging Het
Zfp595 G A 13: 67,317,180 R340C probably damaging Het
Other mutations in Olfr1226
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Olfr1226 APN 2 89193504 missense probably benign 0.00
IGL01073:Olfr1226 APN 2 89193137 missense possibly damaging 0.78
IGL01539:Olfr1226 APN 2 89193492 missense possibly damaging 0.81
IGL01549:Olfr1226 APN 2 89193789 missense probably benign 0.01
IGL02040:Olfr1226 APN 2 89193563 missense probably benign 0.16
IGL02174:Olfr1226 APN 2 89193368 missense probably benign 0.01
IGL02322:Olfr1226 APN 2 89193462 missense probably damaging 0.99
IGL02881:Olfr1226 APN 2 89193641 missense probably damaging 1.00
IGL03336:Olfr1226 APN 2 89193897 missense probably benign 0.16
R1565:Olfr1226 UTSW 2 89193883 missense probably damaging 0.99
R3429:Olfr1226 UTSW 2 89193273 missense probably benign 0.04
R5668:Olfr1226 UTSW 2 89193826 missense possibly damaging 0.60
R6404:Olfr1226 UTSW 2 89193562 missense probably damaging 1.00
R6418:Olfr1226 UTSW 2 89193479 missense probably damaging 0.97
R7039:Olfr1226 UTSW 2 89193446 missense probably damaging 0.96
R7863:Olfr1226 UTSW 2 89193951 missense probably benign
R8097:Olfr1226 UTSW 2 89193632 missense probably damaging 1.00
R8792:Olfr1226 UTSW 2 89193887 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGCATTCAAAGGAGATGGTC -3'
(R):5'- TGCTCTTCTCTCACTCAAGTAGATG -3'

Sequencing Primer
(F):5'- AAGTCTACAATCATCTTGGGGGTGAC -3'
(R):5'- CTTCTCTCACTCAAGTAGATGTTTTC -3'
Posted On2021-01-18