Incidental Mutation 'R8544:Rbl1'
ID 659507
Institutional Source Beutler Lab
Gene Symbol Rbl1
Ensembl Gene ENSMUSG00000027641
Gene Name RB transcriptional corepressor like 1
Synonyms p107
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8544 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 157145893-157204534 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 157193204 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 319 (R319G)
Ref Sequence ENSEMBL: ENSMUSP00000029170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029170]
AlphaFold Q64701
Predicted Effect probably damaging
Transcript: ENSMUST00000029170
AA Change: R319G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029170
Gene: ENSMUSG00000027641
AA Change: R319G

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
DUF3452 70 212 5.14e-78 SMART
RB_A 385 578 9.58e-119 SMART
low complexity region 706 719 N/A INTRINSIC
CYCLIN 800 934 8.68e-6 SMART
Rb_C 947 1063 2.29e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence and possibly function to the product of the retinoblastoma 1 (RB1) gene. The RB1 gene product is a tumor suppressor protein that appears to be involved in cell cycle regulation, as it is phosphorylated in the S to M phase transition and is dephosphorylated in the G1 phase of the cell cycle. Both the RB1 protein and the product of this gene can form a complex with adenovirus E1A protein and SV40 large T-antigen, with the SV40 large T-antigen binding only to the unphosphorylated form of each protein. In addition, both proteins can inhibit the transcription of cell cycle genes containing E2F binding sites in their promoters. Due to the sequence and biochemical similarities with the RB1 protein, it is thought that the protein encoded by this gene may also be a tumor suppressor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are viable and fertile, but may show impaired growth, myeloid hyperplasia in spleen and liver and give rise to cells with a 2X doubling time in vitro. These effects are genetic background dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik C A 15: 37,425,735 probably benign Het
A430105I19Rik C T 2: 118,757,221 R544K unknown Het
Abcb5 A T 12: 118,868,726 L1171H probably damaging Het
Ace A T 11: 105,971,290 probably null Het
Adsl G T 15: 80,948,533 probably benign Het
Cabin1 A G 10: 75,750,056 M215T probably benign Het
Cabp2 A T 19: 4,084,892 R77S probably damaging Het
Cast A T 13: 74,734,058 H40Q possibly damaging Het
Ccar1 A T 10: 62,750,579 Y946N unknown Het
Chst14 A G 2: 118,927,529 Y268C probably damaging Het
Dennd1a T C 2: 37,982,908 probably null Het
Dnah1 A G 14: 31,268,904 Y3153H probably damaging Het
Entpd8 T C 2: 25,083,844 V271A probably benign Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fam126b T C 1: 58,529,822 T477A probably benign Het
Fam234b A G 6: 135,233,289 Y561C probably damaging Het
Flg A G 3: 93,288,141 probably benign Het
Galnt5 T A 2: 58,017,148 M541K probably damaging Het
Gjd3 C A 11: 98,982,662 E119* probably null Het
Gm266 T C 12: 111,485,365 T136A possibly damaging Het
Gng11 G A 6: 4,008,045 C36Y possibly damaging Het
Gse1 G A 8: 120,553,652 V36I probably damaging Het
Invs A T 4: 48,397,598 H335L probably damaging Het
Kcnc2 A T 10: 112,456,196 I28F probably damaging Het
Klhl40 C T 9: 121,778,826 H351Y probably damaging Het
Kremen2 A G 17: 23,742,227 L382P probably benign Het
Lenep A T 3: 89,402,477 C55S possibly damaging Het
Lrp12 A T 15: 39,878,574 Y248* probably null Het
Man2c1 A G 9: 57,131,041 probably null Het
Map2k2 T C 10: 81,119,542 M32T possibly damaging Het
Mnt A G 11: 74,831,392 R22G probably damaging Het
Mroh1 G T 15: 76,443,358 E1127* probably null Het
Mtmr4 A G 11: 87,611,909 R930G possibly damaging Het
Nalcn A G 14: 123,371,523 V644A probably benign Het
Ngf G T 3: 102,520,675 V247F probably damaging Het
Ninj2 A G 6: 120,198,057 Y63C probably damaging Het
Olfr1226 T C 2: 89,193,968 E22G possibly damaging Het
Olfr577 A T 7: 102,973,731 I87N probably damaging Het
Phf12 A C 11: 78,027,409 I816L probably damaging Het
Pkhd1 C A 1: 20,522,975 G1638V probably damaging Het
Plce1 T A 19: 38,524,459 S67R probably benign Het
Plekhf1 A G 7: 38,221,344 F267L probably damaging Het
Poc1b A T 10: 99,124,908 K60* probably null Het
Ppic G A 18: 53,411,540 T66M probably damaging Het
Prep G T 10: 45,153,127 G541V probably damaging Het
Rasal3 C T 17: 32,392,119 V947I probably benign Het
Rbm34 A G 8: 126,970,071 S94P probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Sacm1l T C 9: 123,577,058 probably null Het
Scaf8 T C 17: 3,163,020 probably benign Het
Scrn1 T A 6: 54,522,856 T215S probably benign Het
Sfrp4 A G 13: 19,632,166 probably null Het
Slc37a3 T C 6: 39,344,363 I406V possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sptbn1 C A 11: 30,219,750 probably benign Het
St8sia5 T C 18: 77,254,418 Y275H probably damaging Het
Stab1 A T 14: 31,163,051 C137* probably null Het
Svep1 A G 4: 58,206,025 S118P probably benign Het
Tbx6 A G 7: 126,781,484 probably null Het
Tril C T 6: 53,819,310 S309N possibly damaging Het
Trmt13 A G 3: 116,592,445 probably null Het
Trpm1 T A 7: 64,224,608 probably null Het
Tyr T C 7: 87,492,792 T110A probably benign Het
Upf1 A C 8: 70,337,052 F711C probably damaging Het
Usp5 A T 6: 124,823,517 V267D probably damaging Het
Virma C A 4: 11,516,949 D714E probably benign Het
Vmn2r115 A C 17: 23,345,799 Q220P possibly damaging Het
Vmn2r40 T C 7: 8,908,192 I701V Het
Vwde T A 6: 13,187,653 M612L probably benign Het
Wwox A G 8: 114,488,906 T140A probably benign Het
Zbtb17 CCCCCACCTCCACAGACCCCA CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA 4: 141,466,828 probably benign Het
Zbtb9 T A 17: 26,974,474 C284* probably null Het
Zdhhc12 C A 2: 30,093,474 A39S probably benign Het
Zfp532 T A 18: 65,625,156 I720K possibly damaging Het
Zfp595 G A 13: 67,317,180 R340C probably damaging Het
Other mutations in Rbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Rbl1 APN 2 157152892 splice site probably null
IGL01418:Rbl1 APN 2 157152892 splice site probably null
IGL01597:Rbl1 APN 2 157195449 splice site probably benign
IGL01788:Rbl1 APN 2 157163656 missense probably benign 0.15
IGL02366:Rbl1 APN 2 157174893 missense probably benign 0.18
IGL02527:Rbl1 APN 2 157194048 missense probably benign 0.05
IGL02720:Rbl1 APN 2 157199429 missense possibly damaging 0.94
IGL02828:Rbl1 APN 2 157199464 missense probably damaging 1.00
IGL02926:Rbl1 APN 2 157167413 missense probably benign 0.08
IGL02968:Rbl1 APN 2 157177274 missense probably damaging 1.00
IGL03284:Rbl1 APN 2 157194069 splice site probably benign
R0042:Rbl1 UTSW 2 157175704 splice site probably benign
R0089:Rbl1 UTSW 2 157199414 critical splice donor site probably null
R0173:Rbl1 UTSW 2 157159685 missense probably benign 0.00
R0464:Rbl1 UTSW 2 157147545 missense probably damaging 1.00
R1178:Rbl1 UTSW 2 157147655 missense possibly damaging 0.92
R1296:Rbl1 UTSW 2 157169971 missense probably benign 0.09
R1430:Rbl1 UTSW 2 157169906 missense probably benign
R1445:Rbl1 UTSW 2 157193098 missense probably benign
R1511:Rbl1 UTSW 2 157195634 missense probably damaging 1.00
R1603:Rbl1 UTSW 2 157175659 missense possibly damaging 0.75
R1666:Rbl1 UTSW 2 157159734 missense probably damaging 1.00
R1668:Rbl1 UTSW 2 157159734 missense probably damaging 1.00
R1680:Rbl1 UTSW 2 157174783 missense probably damaging 0.97
R1771:Rbl1 UTSW 2 157163534 splice site probably null
R1833:Rbl1 UTSW 2 157195555 missense probably damaging 0.98
R1852:Rbl1 UTSW 2 157174903 missense probably benign 0.01
R2304:Rbl1 UTSW 2 157147631 missense probably benign 0.02
R3552:Rbl1 UTSW 2 157195585 missense probably benign 0.19
R3605:Rbl1 UTSW 2 157177233 missense probably damaging 1.00
R3607:Rbl1 UTSW 2 157177233 missense probably damaging 1.00
R4160:Rbl1 UTSW 2 157192119 intron probably benign
R4423:Rbl1 UTSW 2 157168955 intron probably benign
R4636:Rbl1 UTSW 2 157167420 missense possibly damaging 0.82
R4780:Rbl1 UTSW 2 157174804 missense probably benign 0.43
R4789:Rbl1 UTSW 2 157177355 missense probably benign
R5145:Rbl1 UTSW 2 157175477 intron probably benign
R5802:Rbl1 UTSW 2 157161433 missense probably benign 0.23
R5851:Rbl1 UTSW 2 157167325 missense probably benign 0.00
R6742:Rbl1 UTSW 2 157169998 missense probably benign 0.19
R6861:Rbl1 UTSW 2 157152967 missense probably damaging 1.00
R6943:Rbl1 UTSW 2 157188286 missense probably benign
R7090:Rbl1 UTSW 2 157152900 missense probably benign 0.02
R7176:Rbl1 UTSW 2 157188325 missense probably damaging 1.00
R7769:Rbl1 UTSW 2 157191980 missense probably benign 0.01
R8032:Rbl1 UTSW 2 157187998 nonsense probably null
R8552:Rbl1 UTSW 2 157196254 missense probably damaging 1.00
R8802:Rbl1 UTSW 2 157196153 critical splice donor site probably null
R8902:Rbl1 UTSW 2 157199500 missense probably benign 0.00
R9032:Rbl1 UTSW 2 157193153 missense probably benign 0.02
R9401:Rbl1 UTSW 2 157174822 missense possibly damaging 0.81
R9420:Rbl1 UTSW 2 157193234 missense probably damaging 0.99
R9747:Rbl1 UTSW 2 157192046 missense probably damaging 0.99
X0057:Rbl1 UTSW 2 157188329 nonsense probably null
X0058:Rbl1 UTSW 2 157174813 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CAGGCATCGTTCACAACTGAG -3'
(R):5'- ACTGTCGTGAATGTTCATACTTGG -3'

Sequencing Primer
(F):5'- TTCACAACTGAGGCCAGGCTAG -3'
(R):5'- CATACTTGGGTAGGAACCTCTGAG -3'
Posted On 2021-01-18