Incidental Mutation 'R8544:Upf1'
ID 659531
Institutional Source Beutler Lab
Gene Symbol Upf1
Ensembl Gene ENSMUSG00000058301
Gene Name UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms B430202H16Rik, Rent1, PNORF-1
MMRRC Submission 068509-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.972) question?
Stock # R8544 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70784175-70805928 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 70789702 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Cysteine at position 711 (F711C)
Ref Sequence ENSEMBL: ENSMUSP00000148927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]
AlphaFold Q9EPU0
Predicted Effect probably damaging
Transcript: ENSMUST00000075666
AA Change: F722C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: F722C

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215817
AA Change: F711C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9306 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik C A 15: 37,425,979 (GRCm39) probably benign Het
Abcb5 A T 12: 118,832,461 (GRCm39) L1171H probably damaging Het
Ace A T 11: 105,862,116 (GRCm39) probably null Het
Adsl G T 15: 80,832,734 (GRCm39) probably benign Het
Cabin1 A G 10: 75,585,890 (GRCm39) M215T probably benign Het
Cabp2 A T 19: 4,134,892 (GRCm39) R77S probably damaging Het
Cast A T 13: 74,882,177 (GRCm39) H40Q possibly damaging Het
Ccar1 A T 10: 62,586,358 (GRCm39) Y946N unknown Het
Ccdc9b C T 2: 118,587,702 (GRCm39) R544K unknown Het
Chst14 A G 2: 118,758,010 (GRCm39) Y268C probably damaging Het
Dennd1a T C 2: 37,872,920 (GRCm39) probably null Het
Dnah1 A G 14: 30,990,861 (GRCm39) Y3153H probably damaging Het
Entpd8 T C 2: 24,973,856 (GRCm39) V271A probably benign Het
Eppk1 C T 15: 75,994,319 (GRCm39) R854Q probably benign Het
Fam234b A G 6: 135,210,287 (GRCm39) Y561C probably damaging Het
Flg A G 3: 93,195,448 (GRCm39) probably benign Het
Galnt5 T A 2: 57,907,160 (GRCm39) M541K probably damaging Het
Gjd3 C A 11: 98,873,488 (GRCm39) E119* probably null Het
Gm266 T C 12: 111,451,799 (GRCm39) T136A possibly damaging Het
Gng11 G A 6: 4,008,045 (GRCm39) C36Y possibly damaging Het
Gse1 G A 8: 121,280,391 (GRCm39) V36I probably damaging Het
Hycc2 T C 1: 58,568,981 (GRCm39) T477A probably benign Het
Invs A T 4: 48,397,598 (GRCm39) H335L probably damaging Het
Kcnc2 A T 10: 112,292,101 (GRCm39) I28F probably damaging Het
Klhl40 C T 9: 121,607,892 (GRCm39) H351Y probably damaging Het
Kremen2 A G 17: 23,961,201 (GRCm39) L382P probably benign Het
Lenep A T 3: 89,309,784 (GRCm39) C55S possibly damaging Het
Lrp12 A T 15: 39,741,970 (GRCm39) Y248* probably null Het
Man2c1 A G 9: 57,038,325 (GRCm39) probably null Het
Map2k2 T C 10: 80,955,376 (GRCm39) M32T possibly damaging Het
Mnt A G 11: 74,722,218 (GRCm39) R22G probably damaging Het
Mroh1 G T 15: 76,327,558 (GRCm39) E1127* probably null Het
Mtmr4 A G 11: 87,502,735 (GRCm39) R930G possibly damaging Het
Nalcn A G 14: 123,608,935 (GRCm39) V644A probably benign Het
Ngf G T 3: 102,427,991 (GRCm39) V247F probably damaging Het
Ninj2 A G 6: 120,175,018 (GRCm39) Y63C probably damaging Het
Or4c121 T C 2: 89,024,312 (GRCm39) E22G possibly damaging Het
Or51g2 A T 7: 102,622,938 (GRCm39) I87N probably damaging Het
Phf12 A C 11: 77,918,235 (GRCm39) I816L probably damaging Het
Pkhd1 C A 1: 20,593,199 (GRCm39) G1638V probably damaging Het
Plce1 T A 19: 38,512,903 (GRCm39) S67R probably benign Het
Plekhf1 A G 7: 37,920,768 (GRCm39) F267L probably damaging Het
Poc1b A T 10: 98,960,770 (GRCm39) K60* probably null Het
Ppic G A 18: 53,544,612 (GRCm39) T66M probably damaging Het
Prep G T 10: 45,029,223 (GRCm39) G541V probably damaging Het
Rasal3 C T 17: 32,611,093 (GRCm39) V947I probably benign Het
Rbl1 T C 2: 157,035,124 (GRCm39) R319G probably damaging Het
Rbm34 A G 8: 127,696,821 (GRCm39) S94P probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Sacm1l T C 9: 123,406,123 (GRCm39) probably null Het
Scaf8 T C 17: 3,213,295 (GRCm39) probably benign Het
Scrn1 T A 6: 54,499,841 (GRCm39) T215S probably benign Het
Sfrp4 A G 13: 19,816,336 (GRCm39) probably null Het
Slc37a3 T C 6: 39,321,297 (GRCm39) I406V possibly damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Sptbn1 C A 11: 30,169,750 (GRCm39) probably benign Het
St8sia5 T C 18: 77,342,114 (GRCm39) Y275H probably damaging Het
Stab1 A T 14: 30,885,008 (GRCm39) C137* probably null Het
Svep1 A G 4: 58,206,025 (GRCm39) S118P probably benign Het
Tbx6 A G 7: 126,380,656 (GRCm39) probably null Het
Tril C T 6: 53,796,295 (GRCm39) S309N possibly damaging Het
Trmt13 A G 3: 116,386,094 (GRCm39) probably null Het
Trpm1 T A 7: 63,874,356 (GRCm39) probably null Het
Tyr T C 7: 87,142,000 (GRCm39) T110A probably benign Het
Usp5 A T 6: 124,800,480 (GRCm39) V267D probably damaging Het
Virma C A 4: 11,516,949 (GRCm39) D714E probably benign Het
Vmn2r115 A C 17: 23,564,773 (GRCm39) Q220P possibly damaging Het
Vmn2r40 T C 7: 8,911,191 (GRCm39) I701V Het
Vwde T A 6: 13,187,652 (GRCm39) M612L probably benign Het
Wwox A G 8: 115,215,646 (GRCm39) T140A probably benign Het
Zbtb17 CCCCCACCTCCACAGACCCCA CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA 4: 141,194,139 (GRCm39) probably benign Het
Zbtb9 T A 17: 27,193,448 (GRCm39) C284* probably null Het
Zdhhc12 C A 2: 29,983,486 (GRCm39) A39S probably benign Het
Zfp532 T A 18: 65,758,227 (GRCm39) I720K possibly damaging Het
Zfp595 G A 13: 67,465,244 (GRCm39) R340C probably damaging Het
Other mutations in Upf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Upf1 APN 8 70,790,934 (GRCm39) missense probably benign
IGL01890:Upf1 APN 8 70,786,880 (GRCm39) missense possibly damaging 0.94
IGL02534:Upf1 APN 8 70,788,302 (GRCm39) critical splice donor site probably null
IGL03142:Upf1 APN 8 70,785,977 (GRCm39) missense probably benign 0.04
IGL03151:Upf1 APN 8 70,788,037 (GRCm39) missense probably damaging 0.98
Nanosphere UTSW 8 70,796,912 (GRCm39) missense probably benign 0.01
Particulate UTSW 8 70,789,675 (GRCm39) missense probably damaging 0.96
R0270:Upf1 UTSW 8 70,788,295 (GRCm39) splice site probably benign
R0477:Upf1 UTSW 8 70,786,730 (GRCm39) missense probably benign
R0755:Upf1 UTSW 8 70,786,779 (GRCm39) missense probably benign 0.01
R1018:Upf1 UTSW 8 70,791,556 (GRCm39) missense possibly damaging 0.85
R1067:Upf1 UTSW 8 70,791,053 (GRCm39) missense probably damaging 0.98
R1445:Upf1 UTSW 8 70,794,174 (GRCm39) missense probably benign 0.00
R1458:Upf1 UTSW 8 70,796,904 (GRCm39) missense probably benign 0.00
R1511:Upf1 UTSW 8 70,791,155 (GRCm39) missense probably damaging 0.99
R1552:Upf1 UTSW 8 70,785,709 (GRCm39) nonsense probably null
R1560:Upf1 UTSW 8 70,791,092 (GRCm39) missense probably damaging 1.00
R1562:Upf1 UTSW 8 70,796,017 (GRCm39) nonsense probably null
R2082:Upf1 UTSW 8 70,794,222 (GRCm39) missense probably damaging 1.00
R2143:Upf1 UTSW 8 70,792,004 (GRCm39) missense probably null 1.00
R2423:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R2425:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3031:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3032:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3123:Upf1 UTSW 8 70,790,133 (GRCm39) splice site probably benign
R3508:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3747:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3748:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3750:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3754:Upf1 UTSW 8 70,792,464 (GRCm39) missense probably benign 0.30
R3964:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3965:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R4152:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R4505:Upf1 UTSW 8 70,790,216 (GRCm39) missense probably damaging 1.00
R4506:Upf1 UTSW 8 70,790,216 (GRCm39) missense probably damaging 1.00
R4838:Upf1 UTSW 8 70,792,018 (GRCm39) missense probably benign 0.03
R5001:Upf1 UTSW 8 70,787,350 (GRCm39) missense probably damaging 1.00
R5715:Upf1 UTSW 8 70,805,628 (GRCm39) missense probably damaging 0.96
R5748:Upf1 UTSW 8 70,791,167 (GRCm39) missense probably damaging 1.00
R5856:Upf1 UTSW 8 70,787,412 (GRCm39) critical splice acceptor site probably null
R5930:Upf1 UTSW 8 70,796,912 (GRCm39) missense probably benign 0.01
R6010:Upf1 UTSW 8 70,789,675 (GRCm39) missense probably damaging 0.96
R6056:Upf1 UTSW 8 70,785,687 (GRCm39) missense probably damaging 0.98
R6870:Upf1 UTSW 8 70,794,211 (GRCm39) missense probably benign 0.11
R7205:Upf1 UTSW 8 70,792,695 (GRCm39) missense possibly damaging 0.94
R7385:Upf1 UTSW 8 70,793,268 (GRCm39) missense probably damaging 1.00
R7464:Upf1 UTSW 8 70,786,073 (GRCm39) missense probably benign
R7759:Upf1 UTSW 8 70,786,730 (GRCm39) missense probably benign
R7783:Upf1 UTSW 8 70,805,508 (GRCm39) missense probably benign 0.11
R8079:Upf1 UTSW 8 70,791,534 (GRCm39) critical splice donor site probably null
R8192:Upf1 UTSW 8 70,793,294 (GRCm39) missense probably benign 0.03
R8738:Upf1 UTSW 8 70,785,973 (GRCm39) missense probably benign 0.06
R8738:Upf1 UTSW 8 70,785,972 (GRCm39) missense probably benign 0.01
R8826:Upf1 UTSW 8 70,790,930 (GRCm39) missense probably benign
R8876:Upf1 UTSW 8 70,796,918 (GRCm39) missense possibly damaging 0.92
R8906:Upf1 UTSW 8 70,786,815 (GRCm39) nonsense probably null
R8911:Upf1 UTSW 8 70,791,087 (GRCm39) missense possibly damaging 0.53
R9163:Upf1 UTSW 8 70,792,674 (GRCm39) missense probably benign
R9425:Upf1 UTSW 8 70,792,003 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCATGGTGAAAGGTATGACGAC -3'
(R):5'- ACTTGAGGGACTTCTTGCTG -3'

Sequencing Primer
(F):5'- TATGACGACCACTGTGGAGC -3'
(R):5'- AGGGACTTCTTGCTGCAGCTAATC -3'
Posted On 2021-01-18