Incidental Mutation 'R8544:Mtmr4'
ID659546
Institutional Source Beutler Lab
Gene Symbol Mtmr4
Ensembl Gene ENSMUSG00000018401
Gene Namemyotubularin related protein 4
SynonymsZFYVE11, FYVE zinc finger phosphatase, ESTM44, FYVE-DSP2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R8544 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87592162-87616302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87611909 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 930 (R930G)
Ref Sequence ENSEMBL: ENSMUSP00000112902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092802] [ENSMUST00000103179] [ENSMUST00000119628]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092802
AA Change: R873G

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401
AA Change: R873G

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103179
AA Change: R930G

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401
AA Change: R930G

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119628
AA Change: R930G

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401
AA Change: R930G

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Meta Mutation Damage Score 0.0784 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik C A 15: 37,425,735 probably benign Het
A430105I19Rik C T 2: 118,757,221 R544K unknown Het
Abcb5 A T 12: 118,868,726 L1171H probably damaging Het
Ace A T 11: 105,971,290 probably null Het
Adsl G T 15: 80,948,533 probably benign Het
Cabin1 A G 10: 75,750,056 M215T probably benign Het
Cabp2 A T 19: 4,084,892 R77S probably damaging Het
Cast A T 13: 74,734,058 H40Q possibly damaging Het
Ccar1 A T 10: 62,750,579 Y946N unknown Het
Chst14 A G 2: 118,927,529 Y268C probably damaging Het
Dennd1a T C 2: 37,982,908 probably null Het
Dnah1 A G 14: 31,268,904 Y3153H probably damaging Het
Entpd8 T C 2: 25,083,844 V271A probably benign Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fam126b T C 1: 58,529,822 T477A probably benign Het
Fam234b A G 6: 135,233,289 Y561C probably damaging Het
Flg A G 3: 93,288,141 probably benign Het
Galnt5 T A 2: 58,017,148 M541K probably damaging Het
Gjd3 C A 11: 98,982,662 E119* probably null Het
Gm266 T C 12: 111,485,365 T136A possibly damaging Het
Gng11 G A 6: 4,008,045 C36Y possibly damaging Het
Gse1 G A 8: 120,553,652 V36I probably damaging Het
Invs A T 4: 48,397,598 H335L probably damaging Het
Kcnc2 A T 10: 112,456,196 I28F probably damaging Het
Klhl40 C T 9: 121,778,826 H351Y probably damaging Het
Kremen2 A G 17: 23,742,227 L382P probably benign Het
Lenep A T 3: 89,402,477 C55S possibly damaging Het
Lrp12 A T 15: 39,878,574 Y248* probably null Het
Man2c1 A G 9: 57,131,041 probably null Het
Map2k2 T C 10: 81,119,542 M32T possibly damaging Het
Mnt A G 11: 74,831,392 R22G probably damaging Het
Mroh1 G T 15: 76,443,358 E1127* probably null Het
Nalcn A G 14: 123,371,523 V644A probably benign Het
Ngf G T 3: 102,520,675 V247F probably damaging Het
Ninj2 A G 6: 120,198,057 Y63C probably damaging Het
Olfr1226 T C 2: 89,193,968 E22G possibly damaging Het
Olfr577 A T 7: 102,973,731 I87N probably damaging Het
Phf12 A C 11: 78,027,409 I816L probably damaging Het
Pkhd1 C A 1: 20,522,975 G1638V probably damaging Het
Plce1 T A 19: 38,524,459 S67R probably benign Het
Plekhf1 A G 7: 38,221,344 F267L probably damaging Het
Poc1b A T 10: 99,124,908 K60* probably null Het
Ppic G A 18: 53,411,540 T66M probably damaging Het
Prep G T 10: 45,153,127 G541V probably damaging Het
Rasal3 C T 17: 32,392,119 V947I probably benign Het
Rbl1 T C 2: 157,193,204 R319G probably damaging Het
Rbm34 A G 8: 126,970,071 S94P probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Sacm1l T C 9: 123,577,058 probably null Het
Scaf8 T C 17: 3,163,020 probably benign Het
Scrn1 T A 6: 54,522,856 T215S probably benign Het
Sfrp4 A G 13: 19,632,166 probably null Het
Slc37a3 T C 6: 39,344,363 I406V possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sptbn1 C A 11: 30,219,750 probably benign Het
St8sia5 T C 18: 77,254,418 Y275H probably damaging Het
Stab1 A T 14: 31,163,051 C137* probably null Het
Svep1 A G 4: 58,206,025 S118P probably benign Het
Tbx6 A G 7: 126,781,484 probably null Het
Tril C T 6: 53,819,310 S309N possibly damaging Het
Trmt13 A G 3: 116,592,445 probably null Het
Trpm1 T A 7: 64,224,608 probably null Het
Tyr T C 7: 87,492,792 T110A probably benign Het
Upf1 A C 8: 70,337,052 F711C probably damaging Het
Usp5 A T 6: 124,823,517 V267D probably damaging Het
Virma C A 4: 11,516,949 D714E probably benign Het
Vmn2r115 A C 17: 23,345,799 Q220P possibly damaging Het
Vmn2r40 T C 7: 8,908,192 I701V Het
Vwde T A 6: 13,187,653 M612L probably benign Het
Wwox A G 8: 114,488,906 T140A probably benign Het
Zbtb17 CCCCCACCTCCACAGACCCCA CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA 4: 141,466,828 probably benign Het
Zbtb9 T A 17: 26,974,474 C284* probably null Het
Zdhhc12 C A 2: 30,093,474 A39S probably benign Het
Zfp532 T A 18: 65,625,156 I720K possibly damaging Het
Zfp595 G A 13: 67,317,180 R340C probably damaging Het
Other mutations in Mtmr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Mtmr4 APN 11 87611924 missense probably benign 0.29
IGL01134:Mtmr4 APN 11 87604067 missense probably damaging 1.00
IGL01317:Mtmr4 APN 11 87602404 unclassified probably benign
IGL01544:Mtmr4 APN 11 87597611 splice site probably benign
IGL01574:Mtmr4 APN 11 87600647 missense probably benign 0.01
IGL01807:Mtmr4 APN 11 87604150 missense possibly damaging 0.55
IGL02059:Mtmr4 APN 11 87601124 missense possibly damaging 0.66
IGL03049:Mtmr4 APN 11 87614234 missense probably damaging 1.00
IGL03196:Mtmr4 APN 11 87600783 missense possibly damaging 0.92
IGL03214:Mtmr4 APN 11 87597693 missense probably damaging 1.00
IGL03258:Mtmr4 APN 11 87612003 missense possibly damaging 0.63
Hippie UTSW 11 87613483 missense probably damaging 1.00
incharge UTSW 11 87611042 nonsense probably null
PIT4802001:Mtmr4 UTSW 11 87611127 missense probably benign
R0009:Mtmr4 UTSW 11 87611508 missense probably benign 0.02
R0564:Mtmr4 UTSW 11 87598888 missense probably damaging 1.00
R0637:Mtmr4 UTSW 11 87611064 missense probably benign 0.30
R0780:Mtmr4 UTSW 11 87611440 missense probably benign 0.03
R1490:Mtmr4 UTSW 11 87612225 missense probably damaging 1.00
R1550:Mtmr4 UTSW 11 87613516 missense probably damaging 1.00
R1777:Mtmr4 UTSW 11 87602830 missense probably damaging 1.00
R1828:Mtmr4 UTSW 11 87612117 missense probably benign 0.26
R2040:Mtmr4 UTSW 11 87605090 missense probably damaging 1.00
R2088:Mtmr4 UTSW 11 87610967 missense probably damaging 0.98
R2497:Mtmr4 UTSW 11 87600823 missense probably damaging 1.00
R2993:Mtmr4 UTSW 11 87604997 missense probably damaging 1.00
R3857:Mtmr4 UTSW 11 87597262 missense probably damaging 0.98
R3858:Mtmr4 UTSW 11 87597262 missense probably damaging 0.98
R4614:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4615:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4616:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4816:Mtmr4 UTSW 11 87604097 missense probably damaging 1.00
R5454:Mtmr4 UTSW 11 87611042 nonsense probably null
R5502:Mtmr4 UTSW 11 87614078 missense probably damaging 1.00
R5566:Mtmr4 UTSW 11 87604530 missense probably damaging 1.00
R5833:Mtmr4 UTSW 11 87605049 nonsense probably null
R5907:Mtmr4 UTSW 11 87612050 missense probably damaging 0.99
R5980:Mtmr4 UTSW 11 87604151 missense probably damaging 1.00
R6077:Mtmr4 UTSW 11 87611019 missense probably damaging 1.00
R6434:Mtmr4 UTSW 11 87613483 missense probably damaging 1.00
R6521:Mtmr4 UTSW 11 87613527 missense possibly damaging 0.86
R7141:Mtmr4 UTSW 11 87600613 missense probably damaging 1.00
R7182:Mtmr4 UTSW 11 87604605 critical splice donor site probably null
R7290:Mtmr4 UTSW 11 87611237 missense probably benign
R7350:Mtmr4 UTSW 11 87600650 missense probably damaging 0.98
R7392:Mtmr4 UTSW 11 87604557 missense probably damaging 1.00
R7447:Mtmr4 UTSW 11 87611901 missense probably damaging 1.00
R7530:Mtmr4 UTSW 11 87611876 missense probably damaging 1.00
R7660:Mtmr4 UTSW 11 87604580 missense probably damaging 0.99
R7713:Mtmr4 UTSW 11 87597724 missense probably damaging 1.00
R7823:Mtmr4 UTSW 11 87612189 missense probably damaging 1.00
R7944:Mtmr4 UTSW 11 87604428 missense probably damaging 1.00
R7945:Mtmr4 UTSW 11 87604428 missense probably damaging 1.00
R8010:Mtmr4 UTSW 11 87598864 missense probably damaging 1.00
R8116:Mtmr4 UTSW 11 87611930 nonsense probably null
R8559:Mtmr4 UTSW 11 87604124 missense probably damaging 1.00
X0062:Mtmr4 UTSW 11 87611825 missense probably damaging 0.99
Z1177:Mtmr4 UTSW 11 87611880 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TGTGCCGGATCTGATCTACAAG -3'
(R):5'- GACTTGCTTCGGATGACTGG -3'

Sequencing Primer
(F):5'- AGCTGTTGGAAAATCCTCGC -3'
(R):5'- CTTGCTTCGGATGACTGGAAAACC -3'
Posted On2021-01-18