Mutagenetix > Incidental Mutation

Incidental Mutation 'R8544:Abcb5'

659550

Institutional Source

Beutler Lab

Gene Symbol

Abcb5

Ensembl Gene

ENSMUSG00000072791

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 5

Synonyms

9230106F14Rik

MMRRC Submission

068509-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.155) question?

Stock #

R8544 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118867824-118966421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118868726 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 1171 (L1171H)

Ref Sequence

ENSEMBL: ENSMUSP00000046177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035515]

AlphaFold

B5X0E4

Predicted Effect

probably damaging
Transcript: ENSMUST00000035515
AA Change: L1171H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: L1171H

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	49	338	1.9e-74	PFAM
AAA	414	606	2.1e-19	SMART
Pfam:ABC_membrane	693	967	7.3e-59	PFAM
Blast:AAA	969	1040	2e-11	BLAST
AAA	1043	1231	8.26e-18	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447A16Rik	C	A	15: 37,425,735		probably benign	Het
A430105I19Rik	C	T	2: 118,757,221	R544K	unknown	Het
Ace	A	T	11: 105,971,290		probably null	Het
Adsl	G	T	15: 80,948,533		probably benign	Het
Cabin1	A	G	10: 75,750,056	M215T	probably benign	Het
Cabp2	A	T	19: 4,084,892	R77S	probably damaging	Het
Cast	A	T	13: 74,734,058	H40Q	possibly damaging	Het
Ccar1	A	T	10: 62,750,579	Y946N	unknown	Het
Chst14	A	G	2: 118,927,529	Y268C	probably damaging	Het
Dennd1a	T	C	2: 37,982,908		probably null	Het
Dnah1	A	G	14: 31,268,904	Y3153H	probably damaging	Het
Entpd8	T	C	2: 25,083,844	V271A	probably benign	Het
Eppk1	C	T	15: 76,110,119	R854Q	probably benign	Het
Fam126b	T	C	1: 58,529,822	T477A	probably benign	Het
Fam234b	A	G	6: 135,233,289	Y561C	probably damaging	Het
Flg	A	G	3: 93,288,141		probably benign	Het
Galnt5	T	A	2: 58,017,148	M541K	probably damaging	Het
Gjd3	C	A	11: 98,982,662	E119*	probably null	Het
Gm266	T	C	12: 111,485,365	T136A	possibly damaging	Het
Gng11	G	A	6: 4,008,045	C36Y	possibly damaging	Het
Gse1	G	A	8: 120,553,652	V36I	probably damaging	Het
Invs	A	T	4: 48,397,598	H335L	probably damaging	Het
Kcnc2	A	T	10: 112,456,196	I28F	probably damaging	Het
Klhl40	C	T	9: 121,778,826	H351Y	probably damaging	Het
Kremen2	A	G	17: 23,742,227	L382P	probably benign	Het
Lenep	A	T	3: 89,402,477	C55S	possibly damaging	Het
Lrp12	A	T	15: 39,878,574	Y248*	probably null	Het
Man2c1	A	G	9: 57,131,041		probably null	Het
Map2k2	T	C	10: 81,119,542	M32T	possibly damaging	Het
Mnt	A	G	11: 74,831,392	R22G	probably damaging	Het
Mroh1	G	T	15: 76,443,358	E1127*	probably null	Het
Mtmr4	A	G	11: 87,611,909	R930G	possibly damaging	Het
Nalcn	A	G	14: 123,371,523	V644A	probably benign	Het
Ngf	G	T	3: 102,520,675	V247F	probably damaging	Het
Ninj2	A	G	6: 120,198,057	Y63C	probably damaging	Het
Olfr1226	T	C	2: 89,193,968	E22G	possibly damaging	Het
Olfr577	A	T	7: 102,973,731	I87N	probably damaging	Het
Phf12	A	C	11: 78,027,409	I816L	probably damaging	Het
Pkhd1	C	A	1: 20,522,975	G1638V	probably damaging	Het
Plce1	T	A	19: 38,524,459	S67R	probably benign	Het
Plekhf1	A	G	7: 38,221,344	F267L	probably damaging	Het
Poc1b	A	T	10: 99,124,908	K60*	probably null	Het
Ppic	G	A	18: 53,411,540	T66M	probably damaging	Het
Prep	G	T	10: 45,153,127	G541V	probably damaging	Het
Rasal3	C	T	17: 32,392,119	V947I	probably benign	Het
Rbl1	T	C	2: 157,193,204	R319G	probably damaging	Het
Rbm34	A	G	8: 126,970,071	S94P	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Sacm1l	T	C	9: 123,577,058		probably null	Het
Scaf8	T	C	17: 3,163,020		probably benign	Het
Scrn1	T	A	6: 54,522,856	T215S	probably benign	Het
Sfrp4	A	G	13: 19,632,166		probably null	Het
Slc37a3	T	C	6: 39,344,363	I406V	possibly damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Sptbn1	C	A	11: 30,219,750		probably benign	Het
St8sia5	T	C	18: 77,254,418	Y275H	probably damaging	Het
Stab1	A	T	14: 31,163,051	C137*	probably null	Het
Svep1	A	G	4: 58,206,025	S118P	probably benign	Het
Tbx6	A	G	7: 126,781,484		probably null	Het
Tril	C	T	6: 53,819,310	S309N	possibly damaging	Het
Trmt13	A	G	3: 116,592,445		probably null	Het
Trpm1	T	A	7: 64,224,608		probably null	Het
Tyr	T	C	7: 87,492,792	T110A	probably benign	Het
Upf1	A	C	8: 70,337,052	F711C	probably damaging	Het
Usp5	A	T	6: 124,823,517	V267D	probably damaging	Het
Virma	C	A	4: 11,516,949	D714E	probably benign	Het
Vmn2r115	A	C	17: 23,345,799	Q220P	possibly damaging	Het
Vmn2r40	T	C	7: 8,908,192	I701V		Het
Vwde	T	A	6: 13,187,653	M612L	probably benign	Het
Wwox	A	G	8: 114,488,906	T140A	probably benign	Het
Zbtb17	CCCCCACCTCCACAGACCCCA	CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA	4: 141,466,828		probably benign	Het
Zbtb9	T	A	17: 26,974,474	C284*	probably null	Het
Zdhhc12	C	A	2: 30,093,474	A39S	probably benign	Het
Zfp532	T	A	18: 65,625,156	I720K	possibly damaging	Het
Zfp595	G	A	13: 67,317,180	R340C	probably damaging	Het

Other mutations in Abcb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Abcb5	APN	12	118890610	missense	probably benign	0.03
IGL00092:Abcb5	APN	12	118928695	missense	probably benign	0.09
IGL00503:Abcb5	APN	12	118907601	missense	probably benign	0.02
IGL00776:Abcb5	APN	12	118919854	missense	probably damaging	1.00
IGL01116:Abcb5	APN	12	118886176	missense	probably benign
IGL01302:Abcb5	APN	12	118918200	missense	probably damaging	1.00
IGL01403:Abcb5	APN	12	118872867	missense	probably damaging	1.00
IGL01453:Abcb5	APN	12	118867970	missense	probably damaging	1.00
IGL01541:Abcb5	APN	12	118911434	missense	probably benign	0.03
IGL01784:Abcb5	APN	12	118890664	missense	probably benign	0.14
IGL01967:Abcb5	APN	12	118867972	missense	probably damaging	1.00
IGL01987:Abcb5	APN	12	118927358	missense	probably damaging	1.00
IGL02104:Abcb5	APN	12	118940680	missense	probably damaging	1.00
IGL02161:Abcb5	APN	12	118874755	missense	probably benign
IGL02292:Abcb5	APN	12	118918197	missense	probably damaging	1.00
IGL02381:Abcb5	APN	12	118940678	missense	probably damaging	1.00
IGL02544:Abcb5	APN	12	118906268	splice site	probably benign
IGL02685:Abcb5	APN	12	118905947	missense	probably damaging	0.99
IGL02824:Abcb5	APN	12	118890685	missense	probably benign	0.05
IGL02876:Abcb5	APN	12	118919841	missense	probably damaging	1.00
IGL02929:Abcb5	APN	12	118944939	missense	probably damaging	0.99
IGL03030:Abcb5	APN	12	118940369	missense	possibly damaging	0.93
IGL03062:Abcb5	APN	12	118936087	missense	probably benign	0.43
IGL03200:Abcb5	APN	12	118965254	splice site	probably benign
IGL03407:Abcb5	APN	12	118940376	missense	probably benign	0.01
alphabet	UTSW	12	118890618	missense	possibly damaging	0.67
google	UTSW	12	118867930	missense	possibly damaging	0.93
F5770:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
PIT4366001:Abcb5	UTSW	12	118936098	missense	probably damaging	1.00
PIT4434001:Abcb5	UTSW	12	118890687	missense	probably damaging	1.00
R0078:Abcb5	UTSW	12	118927394	missense	probably benign
R0219:Abcb5	UTSW	12	118886150	splice site	probably benign
R0312:Abcb5	UTSW	12	118872837	missense	probably damaging	1.00
R0347:Abcb5	UTSW	12	118965251	splice site	probably benign
R0359:Abcb5	UTSW	12	118940332	missense	probably damaging	1.00
R0433:Abcb5	UTSW	12	118877810	missense	probably benign	0.03
R0582:Abcb5	UTSW	12	118940412	missense	probably benign	0.40
R0815:Abcb5	UTSW	12	118901449	splice site	probably benign
R0900:Abcb5	UTSW	12	118940624	missense	probably damaging	1.00
R0942:Abcb5	UTSW	12	118906198	missense	possibly damaging	0.94
R0988:Abcb5	UTSW	12	118932575	missense	probably benign	0.36
R1125:Abcb5	UTSW	12	118911547	missense	possibly damaging	0.87
R1437:Abcb5	UTSW	12	118874762	missense	probably damaging	0.99
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1678:Abcb5	UTSW	12	118965329	start gained	probably benign
R1726:Abcb5	UTSW	12	118874801	splice site	probably null
R1726:Abcb5	UTSW	12	118907532	missense	possibly damaging	0.95
R1836:Abcb5	UTSW	12	118867961	missense	possibly damaging	0.93
R1934:Abcb5	UTSW	12	118907500	splice site	probably null
R1976:Abcb5	UTSW	12	118890682	missense	probably benign
R2005:Abcb5	UTSW	12	118877827	missense	probably benign	0.15
R2068:Abcb5	UTSW	12	118940568	nonsense	probably null
R2181:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R2191:Abcb5	UTSW	12	118867956	missense	probably damaging	1.00
R3690:Abcb5	UTSW	12	118872933	missense	probably damaging	1.00
R3746:Abcb5	UTSW	12	118874620	missense	probably damaging	0.99
R3825:Abcb5	UTSW	12	118901352	splice site	probably null
R3919:Abcb5	UTSW	12	118890618	missense	possibly damaging	0.67
R4049:Abcb5	UTSW	12	118868669	missense	probably damaging	0.99
R4409:Abcb5	UTSW	12	118872922	missense	probably damaging	0.98
R4606:Abcb5	UTSW	12	118932610	critical splice acceptor site	probably null
R4705:Abcb5	UTSW	12	118965305	missense	possibly damaging	0.95
R4954:Abcb5	UTSW	12	118911434	missense	probably benign	0.03
R4966:Abcb5	UTSW	12	118886891	intron	probably benign
R5169:Abcb5	UTSW	12	118877817	nonsense	probably null
R5327:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R5333:Abcb5	UTSW	12	118867942	missense	probably damaging	1.00
R5366:Abcb5	UTSW	12	118867930	missense	possibly damaging	0.93
R5373:Abcb5	UTSW	12	118887177	missense	probably damaging	1.00
R5399:Abcb5	UTSW	12	118911499	missense	probably benign
R5416:Abcb5	UTSW	12	118907596	missense	probably damaging	1.00
R5447:Abcb5	UTSW	12	118927326	missense	probably damaging	1.00
R5474:Abcb5	UTSW	12	118940690	missense	probably null	1.00
R5566:Abcb5	UTSW	12	118935967	missense	probably damaging	0.99
R5685:Abcb5	UTSW	12	118932613	splice site	probably null
R5691:Abcb5	UTSW	12	118927235	missense	probably damaging	0.99
R5742:Abcb5	UTSW	12	118918257	missense	probably damaging	0.96
R5852:Abcb5	UTSW	12	118927404	missense	probably damaging	0.99
R5917:Abcb5	UTSW	12	118868781	nonsense	probably null
R5994:Abcb5	UTSW	12	118965260	critical splice donor site	probably null
R6295:Abcb5	UTSW	12	118874644	missense	probably damaging	0.99
R6455:Abcb5	UTSW	12	118890549	critical splice donor site	probably null
R6609:Abcb5	UTSW	12	118928762	missense	probably damaging	1.00
R6753:Abcb5	UTSW	12	118944906	missense	possibly damaging	0.86
R6818:Abcb5	UTSW	12	118901354	splice site	probably null
R6870:Abcb5	UTSW	12	118965265	missense	possibly damaging	0.87
R6944:Abcb5	UTSW	12	118911530	missense	probably benign	0.06
R6957:Abcb5	UTSW	12	118907535	missense	probably damaging	1.00
R6984:Abcb5	UTSW	12	118927277	missense	possibly damaging	0.47
R7021:Abcb5	UTSW	12	118931925	missense	probably benign	0.00
R7061:Abcb5	UTSW	12	118877774	missense	probably damaging	1.00
R7175:Abcb5	UTSW	12	118867876	missense	probably benign	0.00
R7239:Abcb5	UTSW	12	118928725	missense	probably benign	0.19
R7267:Abcb5	UTSW	12	118952470	missense	probably damaging	1.00
R7303:Abcb5	UTSW	12	118911560	missense	probably damaging	0.96
R7396:Abcb5	UTSW	12	118867874	missense	probably damaging	1.00
R7605:Abcb5	UTSW	12	118918164	missense	probably damaging	1.00
R7989:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R8177:Abcb5	UTSW	12	118872790	missense	possibly damaging	0.65
R8296:Abcb5	UTSW	12	118874732	missense	probably benign	0.01
R8558:Abcb5	UTSW	12	118877831	missense	probably benign	0.07
R8790:Abcb5	UTSW	12	118867885	missense	possibly damaging	0.91
R9003:Abcb5	UTSW	12	118886278	missense	possibly damaging	0.93
R9038:Abcb5	UTSW	12	118931916	missense	probably benign
R9410:Abcb5	UTSW	12	118905968	missense	probably benign	0.00
R9497:Abcb5	UTSW	12	118936115	missense	probably damaging	0.96
R9666:Abcb5	UTSW	12	118874687	missense	probably damaging	0.98
R9682:Abcb5	UTSW	12	118932593	missense	probably damaging	0.99
R9756:Abcb5	UTSW	12	118918138	missense	probably damaging	0.98
V7580:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
Z1176:Abcb5	UTSW	12	118918272	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTTGCCCAGCTTCAATC -3'
(R):5'- ACGGCCATGGTGTTCATAGG -3'

Sequencing Primer
(F):5'- GTTGCCCAGCTTCAATCCTCTC -3'
(R):5'- TGTATCGGGACACACCTTTCAAGAG -3'

Posted On

2021-01-18