Incidental Mutation 'R8546:Clca3b'
ID659621
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Namechloride channel accessory 3B
SynonymsClca4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8546 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location144822623-144849357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144827397 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 625 (S625C)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
Predicted Effect probably damaging
Transcript: ENSMUST00000159989
AA Change: S625C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: S625C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A G 11: 101,990,861 R77G probably damaging Het
Acot1 T C 12: 84,017,365 S416P probably benign Het
Adcy9 G T 16: 4,418,905 A214E probably benign Het
Atp11a T A 8: 12,851,083 W971R probably damaging Het
Axl C T 7: 25,774,163 R346H probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cabin1 T C 10: 75,742,267 D532G probably damaging Het
Cdh20 A G 1: 104,934,044 probably benign Het
Col3a1 G A 1: 45,340,939 probably benign Het
Ctu2 T C 8: 122,479,363 L281P probably damaging Het
Cyb5a G A 18: 84,871,634 probably null Het
Cyb5rl T A 4: 107,068,726 V35D probably damaging Het
Dnah17 A G 11: 118,124,275 F381S probably benign Het
Eif3a A T 19: 60,766,770 N991K unknown Het
Eif6 A G 2: 155,826,500 probably benign Het
Fahd1 T C 17: 24,850,083 M7V possibly damaging Het
Fam171b A G 2: 83,855,451 T160A probably damaging Het
Fnip1 A G 11: 54,510,000 E1075G probably benign Het
Fras1 G A 5: 96,709,966 V2040I probably benign Het
Gjc2 G T 11: 59,176,356 D433E unknown Het
Gm14085 A T 2: 122,522,754 M472L probably benign Het
Hist1h2bl G A 13: 21,715,872 T91M probably damaging Het
Igsf9b T C 9: 27,333,130 S794P possibly damaging Het
Irx6 A T 8: 92,678,636 R377S probably benign Het
Khnyn A G 14: 55,885,818 T10A probably benign Het
Kmt2e A T 5: 23,481,244 H389L probably damaging Het
Lin7c A G 2: 109,896,371 I122V probably null Het
Lonp1 G A 17: 56,626,702 P58S probably benign Het
Loxl4 T C 19: 42,607,588 H142R probably benign Het
Mcm6 C T 1: 128,345,948 E382K possibly damaging Het
Mettl2 T A 11: 105,131,573 N196K probably benign Het
Myo7b T C 18: 31,990,148 E712G probably benign Het
Ncam2 C T 16: 81,517,531 T465I probably benign Het
Olfr860 T A 9: 19,846,389 T77S probably damaging Het
Padi4 T C 4: 140,757,530 E340G probably damaging Het
Patj T A 4: 98,437,397 S490R probably benign Het
Pkd1l3 G A 8: 109,666,983 S1981N possibly damaging Het
Poll T A 19: 45,557,977 D208V probably damaging Het
Polr3f A G 2: 144,532,364 D64G probably damaging Het
Prkdc A G 16: 15,663,035 Y340C probably damaging Het
Prmt6 C T 3: 110,250,718 R85Q possibly damaging Het
Rgl3 T C 9: 21,987,860 K140R probably benign Het
Rhoj A G 12: 75,375,350 T61A probably benign Het
Skor1 T C 9: 63,142,288 D795G probably damaging Het
Tekt5 A G 16: 10,358,013 V556A probably benign Het
Tlr1 T A 5: 64,927,031 I68F probably damaging Het
Tnni3k G T 3: 154,792,807 N798K probably benign Het
Tuft1 T A 3: 94,622,113 E227D probably benign Het
Tulp1 T C 17: 28,363,736 K146R probably benign Het
Uhrf1bp1l A G 10: 89,794,535 N399S probably damaging Het
Usp24 G A 4: 106,402,129 A1616T probably benign Het
Ythdc1 A T 5: 86,826,748 K452N possibly damaging Het
Zscan4-ps3 T A 7: 11,612,770 H244Q possibly damaging Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144836632 missense probably damaging 0.96
IGL00425:Clca3b APN 3 144836581 missense probably benign 0.14
IGL00725:Clca3b APN 3 144839162 missense probably benign 0.01
IGL00898:Clca3b APN 3 144844628 splice site probably benign
IGL00953:Clca3b APN 3 144847211 nonsense probably null
IGL01089:Clca3b APN 3 144823522 missense probably benign
IGL01376:Clca3b APN 3 144826051 missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144849163 missense probably benign 0.04
IGL02022:Clca3b APN 3 144841410 critical splice donor site probably null
IGL02200:Clca3b APN 3 144841429 missense probably damaging 1.00
IGL02314:Clca3b APN 3 144828142 splice site probably benign
IGL02331:Clca3b APN 3 144841406 splice site probably benign
IGL02429:Clca3b APN 3 144828135 missense probably damaging 1.00
IGL02868:Clca3b APN 3 144827564 missense probably damaging 1.00
IGL03095:Clca3b APN 3 144846910 nonsense probably null
IGL03331:Clca3b APN 3 144827963 missense probably benign
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0506:Clca3b UTSW 3 144822866 unclassified probably benign
R0524:Clca3b UTSW 3 144825321 missense probably benign
R0637:Clca3b UTSW 3 144827940 missense probably benign 0.03
R1577:Clca3b UTSW 3 144823519 missense probably damaging 1.00
R1641:Clca3b UTSW 3 144823513 missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144837824 missense probably damaging 1.00
R2240:Clca3b UTSW 3 144825935 missense probably benign 0.22
R2248:Clca3b UTSW 3 144825219 missense probably benign 0.01
R2259:Clca3b UTSW 3 144846381 missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144837853 missense probably benign 0.31
R2920:Clca3b UTSW 3 144846931 missense probably benign 0.01
R4355:Clca3b UTSW 3 144825458 splice site probably null
R4691:Clca3b UTSW 3 144839092 missense probably benign 0.02
R4828:Clca3b UTSW 3 144844512 missense probably benign 0.02
R4845:Clca3b UTSW 3 144825270 missense probably benign
R5182:Clca3b UTSW 3 144828015 missense probably damaging 0.99
R5396:Clca3b UTSW 3 144847171 missense probably damaging 0.99
R5429:Clca3b UTSW 3 144846459 missense probably damaging 1.00
R5572:Clca3b UTSW 3 144827309 missense probably damaging 1.00
R5657:Clca3b UTSW 3 144827383 missense probably benign 0.25
R5845:Clca3b UTSW 3 144825316 missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144825259 missense probably benign 0.18
R6677:Clca3b UTSW 3 144823384 missense probably benign 0.13
R6707:Clca3b UTSW 3 144844527 missense probably benign 0.00
R7001:Clca3b UTSW 3 144827972 missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144837758 missense probably benign 0.00
R7323:Clca3b UTSW 3 144825920 missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144841420 missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144836656 nonsense probably null
R7403:Clca3b UTSW 3 144823498 missense probably benign 0.00
R7798:Clca3b UTSW 3 144828130 missense probably damaging 1.00
R8008:Clca3b UTSW 3 144844609 missense probably benign 0.44
R8132:Clca3b UTSW 3 144847174 missense probably benign 0.13
R8181:Clca3b UTSW 3 144839137 missense probably benign 0.00
R8305:Clca3b UTSW 3 144825937 missense probably damaging 1.00
R8716:Clca3b UTSW 3 144844594 missense probably benign 0.14
R8804:Clca3b UTSW 3 144839137 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGCAGAGGTTTAACACATTG -3'
(R):5'- TTTTCAGACAGGCACTTGGAC -3'

Sequencing Primer
(F):5'- CAGAGGTTTAACACATTGCAGCTAG -3'
(R):5'- TTCAGACAGGCACTTGGACTTACAG -3'
Posted On2021-01-18