Incidental Mutation 'R8546:Clca3b'
ID 659621
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Name chloride channel accessory 3B
Synonyms Clca4
MMRRC Submission 068511-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8546 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144528384-144555063 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144533158 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 625 (S625C)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
AlphaFold E9PUL3
Predicted Effect probably damaging
Transcript: ENSMUST00000159989
AA Change: S625C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: S625C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T C 12: 84,064,139 (GRCm39) S416P probably benign Het
Adcy9 G T 16: 4,236,769 (GRCm39) A214E probably benign Het
Atp11a T A 8: 12,901,083 (GRCm39) W971R probably damaging Het
Axl C T 7: 25,473,588 (GRCm39) R346H probably benign Het
Bltp3b A G 10: 89,630,397 (GRCm39) N399S probably damaging Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Cabin1 T C 10: 75,578,101 (GRCm39) D532G probably damaging Het
Cdh20 A G 1: 104,861,769 (GRCm39) probably benign Het
Cfap97d1 A G 11: 101,881,687 (GRCm39) R77G probably damaging Het
Col3a1 G A 1: 45,380,099 (GRCm39) probably benign Het
Ctu2 T C 8: 123,206,102 (GRCm39) L281P probably damaging Het
Cyb5a G A 18: 84,889,759 (GRCm39) probably null Het
Cyb5rl T A 4: 106,925,923 (GRCm39) V35D probably damaging Het
Dnah17 A G 11: 118,015,101 (GRCm39) F381S probably benign Het
Eif3a A T 19: 60,755,208 (GRCm39) N991K unknown Het
Eif6 A G 2: 155,668,420 (GRCm39) probably benign Het
Fahd1 T C 17: 25,069,057 (GRCm39) M7V possibly damaging Het
Fam171b A G 2: 83,685,795 (GRCm39) T160A probably damaging Het
Fnip1 A G 11: 54,400,826 (GRCm39) E1075G probably benign Het
Fras1 G A 5: 96,857,825 (GRCm39) V2040I probably benign Het
Gjc2 G T 11: 59,067,182 (GRCm39) D433E unknown Het
H2bc13 G A 13: 21,900,042 (GRCm39) T91M probably damaging Het
Igsf9b T C 9: 27,244,426 (GRCm39) S794P possibly damaging Het
Irx6 A T 8: 93,405,264 (GRCm39) R377S probably benign Het
Khnyn A G 14: 56,123,275 (GRCm39) T10A probably benign Het
Kmt2e A T 5: 23,686,242 (GRCm39) H389L probably damaging Het
Lin7c A G 2: 109,726,716 (GRCm39) I122V probably null Het
Lonp1 G A 17: 56,933,702 (GRCm39) P58S probably benign Het
Loxl4 T C 19: 42,596,027 (GRCm39) H142R probably benign Het
Mcm6 C T 1: 128,273,685 (GRCm39) E382K possibly damaging Het
Mettl2 T A 11: 105,022,399 (GRCm39) N196K probably benign Het
Myo7b T C 18: 32,123,201 (GRCm39) E712G probably benign Het
Ncam2 C T 16: 81,314,419 (GRCm39) T465I probably benign Het
Or7e169 T A 9: 19,757,685 (GRCm39) T77S probably damaging Het
Padi4 T C 4: 140,484,841 (GRCm39) E340G probably damaging Het
Patj T A 4: 98,325,634 (GRCm39) S490R probably benign Het
Pkd1l3 G A 8: 110,393,615 (GRCm39) S1981N possibly damaging Het
Poll T A 19: 45,546,416 (GRCm39) D208V probably damaging Het
Polr3f A G 2: 144,374,284 (GRCm39) D64G probably damaging Het
Prkdc A G 16: 15,480,899 (GRCm39) Y340C probably damaging Het
Prmt6 C T 3: 110,158,034 (GRCm39) R85Q possibly damaging Het
Rgl3 T C 9: 21,899,156 (GRCm39) K140R probably benign Het
Rhoj A G 12: 75,422,124 (GRCm39) T61A probably benign Het
Skor1 T C 9: 63,049,570 (GRCm39) D795G probably damaging Het
Slc28a2b A T 2: 122,353,235 (GRCm39) M472L probably benign Het
Tekt5 A G 16: 10,175,877 (GRCm39) V556A probably benign Het
Tlr1 T A 5: 65,084,374 (GRCm39) I68F probably damaging Het
Tnni3k G T 3: 154,498,444 (GRCm39) N798K probably benign Het
Tuft1 T A 3: 94,529,420 (GRCm39) E227D probably benign Het
Tulp1 T C 17: 28,582,710 (GRCm39) K146R probably benign Het
Usp24 G A 4: 106,259,326 (GRCm39) A1616T probably benign Het
Ythdc1 A T 5: 86,974,607 (GRCm39) K452N possibly damaging Het
Zscan4-ps3 T A 7: 11,346,697 (GRCm39) H244Q possibly damaging Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144,542,393 (GRCm39) missense probably damaging 0.96
IGL00425:Clca3b APN 3 144,542,342 (GRCm39) missense probably benign 0.14
IGL00725:Clca3b APN 3 144,544,923 (GRCm39) missense probably benign 0.01
IGL00898:Clca3b APN 3 144,550,389 (GRCm39) splice site probably benign
IGL00953:Clca3b APN 3 144,552,972 (GRCm39) nonsense probably null
IGL01089:Clca3b APN 3 144,529,283 (GRCm39) missense probably benign
IGL01376:Clca3b APN 3 144,531,812 (GRCm39) missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144,554,924 (GRCm39) missense probably benign 0.04
IGL02022:Clca3b APN 3 144,547,171 (GRCm39) critical splice donor site probably null
IGL02200:Clca3b APN 3 144,547,190 (GRCm39) missense probably damaging 1.00
IGL02314:Clca3b APN 3 144,533,903 (GRCm39) splice site probably benign
IGL02331:Clca3b APN 3 144,547,167 (GRCm39) splice site probably benign
IGL02429:Clca3b APN 3 144,533,896 (GRCm39) missense probably damaging 1.00
IGL02868:Clca3b APN 3 144,533,325 (GRCm39) missense probably damaging 1.00
IGL03095:Clca3b APN 3 144,552,671 (GRCm39) nonsense probably null
IGL03331:Clca3b APN 3 144,533,724 (GRCm39) missense probably benign
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0506:Clca3b UTSW 3 144,528,627 (GRCm39) unclassified probably benign
R0524:Clca3b UTSW 3 144,531,082 (GRCm39) missense probably benign
R0637:Clca3b UTSW 3 144,533,701 (GRCm39) missense probably benign 0.03
R1577:Clca3b UTSW 3 144,529,280 (GRCm39) missense probably damaging 1.00
R1641:Clca3b UTSW 3 144,529,274 (GRCm39) missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144,543,585 (GRCm39) missense probably damaging 1.00
R2240:Clca3b UTSW 3 144,531,696 (GRCm39) missense probably benign 0.22
R2248:Clca3b UTSW 3 144,530,980 (GRCm39) missense probably benign 0.01
R2259:Clca3b UTSW 3 144,552,142 (GRCm39) missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144,552,692 (GRCm39) missense probably benign 0.01
R2920:Clca3b UTSW 3 144,543,614 (GRCm39) missense probably benign 0.31
R4355:Clca3b UTSW 3 144,531,219 (GRCm39) splice site probably null
R4691:Clca3b UTSW 3 144,544,853 (GRCm39) missense probably benign 0.02
R4828:Clca3b UTSW 3 144,550,273 (GRCm39) missense probably benign 0.02
R4845:Clca3b UTSW 3 144,531,031 (GRCm39) missense probably benign
R5182:Clca3b UTSW 3 144,533,776 (GRCm39) missense probably damaging 0.99
R5396:Clca3b UTSW 3 144,552,932 (GRCm39) missense probably damaging 0.99
R5429:Clca3b UTSW 3 144,552,220 (GRCm39) missense probably damaging 1.00
R5572:Clca3b UTSW 3 144,533,070 (GRCm39) missense probably damaging 1.00
R5657:Clca3b UTSW 3 144,533,144 (GRCm39) missense probably benign 0.25
R5845:Clca3b UTSW 3 144,531,077 (GRCm39) missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144,531,020 (GRCm39) missense probably benign 0.18
R6677:Clca3b UTSW 3 144,529,145 (GRCm39) missense probably benign 0.13
R6707:Clca3b UTSW 3 144,550,288 (GRCm39) missense probably benign 0.00
R7001:Clca3b UTSW 3 144,533,733 (GRCm39) missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144,543,519 (GRCm39) missense probably benign 0.00
R7323:Clca3b UTSW 3 144,531,681 (GRCm39) missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144,547,181 (GRCm39) missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144,542,417 (GRCm39) nonsense probably null
R7403:Clca3b UTSW 3 144,529,259 (GRCm39) missense probably benign 0.00
R7798:Clca3b UTSW 3 144,533,891 (GRCm39) missense probably damaging 1.00
R8008:Clca3b UTSW 3 144,550,370 (GRCm39) missense probably benign 0.44
R8132:Clca3b UTSW 3 144,552,935 (GRCm39) missense probably benign 0.13
R8181:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8305:Clca3b UTSW 3 144,531,698 (GRCm39) missense probably damaging 1.00
R8716:Clca3b UTSW 3 144,550,355 (GRCm39) missense probably benign 0.14
R8804:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8966:Clca3b UTSW 3 144,544,872 (GRCm39) missense probably benign 0.27
R9003:Clca3b UTSW 3 144,533,072 (GRCm39) nonsense probably null
R9455:Clca3b UTSW 3 144,529,023 (GRCm39) missense unknown
R9470:Clca3b UTSW 3 144,543,456 (GRCm39) missense probably damaging 1.00
R9658:Clca3b UTSW 3 144,543,575 (GRCm39) missense probably damaging 0.98
R9760:Clca3b UTSW 3 144,552,610 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGCAGAGGTTTAACACATTG -3'
(R):5'- TTTTCAGACAGGCACTTGGAC -3'

Sequencing Primer
(F):5'- CAGAGGTTTAACACATTGCAGCTAG -3'
(R):5'- TTCAGACAGGCACTTGGACTTACAG -3'
Posted On 2021-01-18