Incidental Mutation 'R8546:Kmt2e'
ID 659627
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Name lysine (K)-specific methyltransferase 2E
Synonyms D230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8546 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 23434441-23504235 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23481244 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 389 (H389L)
Ref Sequence ENSEMBL: ENSMUSP00000110781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000146375] [ENSMUST00000196260] [ENSMUST00000196889]
AlphaFold Q3UG20
Predicted Effect probably damaging
Transcript: ENSMUST00000094962
AA Change: H389L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: H389L

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000115128
AA Change: H389L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: H389L

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000146375
SMART Domains Protein: ENSMUSP00000142547
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 104 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196260
SMART Domains Protein: ENSMUSP00000143791
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196889
SMART Domains Protein: ENSMUSP00000142568
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 2.7e-10 SMART
Blast:SET 216 327 6e-61 BLAST
Blast:SET 328 377 3e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A G 11: 101,990,861 R77G probably damaging Het
Acot1 T C 12: 84,017,365 S416P probably benign Het
Adcy9 G T 16: 4,418,905 A214E probably benign Het
Atp11a T A 8: 12,851,083 W971R probably damaging Het
Axl C T 7: 25,774,163 R346H probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cabin1 T C 10: 75,742,267 D532G probably damaging Het
Cdh20 A G 1: 104,934,044 probably benign Het
Clca3b T A 3: 144,827,397 S625C probably damaging Het
Col3a1 G A 1: 45,340,939 probably benign Het
Ctu2 T C 8: 122,479,363 L281P probably damaging Het
Cyb5a G A 18: 84,871,634 probably null Het
Cyb5rl T A 4: 107,068,726 V35D probably damaging Het
Dnah17 A G 11: 118,124,275 F381S probably benign Het
Eif3a A T 19: 60,766,770 N991K unknown Het
Eif6 A G 2: 155,826,500 probably benign Het
Fahd1 T C 17: 24,850,083 M7V possibly damaging Het
Fam171b A G 2: 83,855,451 T160A probably damaging Het
Fnip1 A G 11: 54,510,000 E1075G probably benign Het
Fras1 G A 5: 96,709,966 V2040I probably benign Het
Gjc2 G T 11: 59,176,356 D433E unknown Het
Gm14085 A T 2: 122,522,754 M472L probably benign Het
Hist1h2bl G A 13: 21,715,872 T91M probably damaging Het
Igsf9b T C 9: 27,333,130 S794P possibly damaging Het
Irx6 A T 8: 92,678,636 R377S probably benign Het
Khnyn A G 14: 55,885,818 T10A probably benign Het
Lin7c A G 2: 109,896,371 I122V probably null Het
Lonp1 G A 17: 56,626,702 P58S probably benign Het
Loxl4 T C 19: 42,607,588 H142R probably benign Het
Mcm6 C T 1: 128,345,948 E382K possibly damaging Het
Mettl2 T A 11: 105,131,573 N196K probably benign Het
Myo7b T C 18: 31,990,148 E712G probably benign Het
Ncam2 C T 16: 81,517,531 T465I probably benign Het
Olfr860 T A 9: 19,846,389 T77S probably damaging Het
Padi4 T C 4: 140,757,530 E340G probably damaging Het
Patj T A 4: 98,437,397 S490R probably benign Het
Pkd1l3 G A 8: 109,666,983 S1981N possibly damaging Het
Poll T A 19: 45,557,977 D208V probably damaging Het
Polr3f A G 2: 144,532,364 D64G probably damaging Het
Prkdc A G 16: 15,663,035 Y340C probably damaging Het
Prmt6 C T 3: 110,250,718 R85Q possibly damaging Het
Rgl3 T C 9: 21,987,860 K140R probably benign Het
Rhoj A G 12: 75,375,350 T61A probably benign Het
Skor1 T C 9: 63,142,288 D795G probably damaging Het
Tekt5 A G 16: 10,358,013 V556A probably benign Het
Tlr1 T A 5: 64,927,031 I68F probably damaging Het
Tnni3k G T 3: 154,792,807 N798K probably benign Het
Tuft1 T A 3: 94,622,113 E227D probably benign Het
Tulp1 T C 17: 28,363,736 K146R probably benign Het
Uhrf1bp1l A G 10: 89,794,535 N399S probably damaging Het
Usp24 G A 4: 106,402,129 A1616T probably benign Het
Ythdc1 A T 5: 86,826,748 K452N possibly damaging Het
Zscan4-ps3 T A 7: 11,612,770 H244Q possibly damaging Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23492358 missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23497948 missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23502019 missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23497091 missense probably benign
IGL02274:Kmt2e APN 5 23500760 missense probably benign 0.00
IGL02934:Kmt2e APN 5 23497884 missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23467100 splice site probably benign
IGL03011:Kmt2e APN 5 23497542 missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23499291 missense probably damaging 1.00
R0035:Kmt2e UTSW 5 23485621 splice site probably benign
R0446:Kmt2e UTSW 5 23497534 splice site probably null
R0498:Kmt2e UTSW 5 23478972 nonsense probably null
R0699:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0701:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0761:Kmt2e UTSW 5 23503034 nonsense probably null
R1110:Kmt2e UTSW 5 23502655 missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23502404 missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23450321 missense probably benign 0.39
R1495:Kmt2e UTSW 5 23499327 missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23500535 missense probably null 0.01
R1623:Kmt2e UTSW 5 23482502 missense probably damaging 1.00
R1675:Kmt2e UTSW 5 23482453 nonsense probably null
R1691:Kmt2e UTSW 5 23464849 missense probably damaging 1.00
R1778:Kmt2e UTSW 5 23492364 missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23473547 missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23499486 intron probably benign
R1912:Kmt2e UTSW 5 23492395 missense probably benign 0.07
R2070:Kmt2e UTSW 5 23501995 missense probably benign
R2195:Kmt2e UTSW 5 23502196 splice site probably null
R2571:Kmt2e UTSW 5 23501887 missense probably benign 0.08
R3901:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3902:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3905:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3906:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3909:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3956:Kmt2e UTSW 5 23496025 missense probably benign 0.00
R4242:Kmt2e UTSW 5 23502822 unclassified probably benign
R4299:Kmt2e UTSW 5 23464914 missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23464790 missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23473558 missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23492407 missense possibly damaging 0.60
R4719:Kmt2e UTSW 5 23492315 missense probably damaging 1.00
R4754:Kmt2e UTSW 5 23482441 missense possibly damaging 0.88
R4787:Kmt2e UTSW 5 23463083 missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23502587 missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23502341 missense probably damaging 1.00
R5138:Kmt2e UTSW 5 23502695 missense probably damaging 0.99
R5306:Kmt2e UTSW 5 23499333 missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23497807 missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23464706 missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23499442 missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23499516 missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23493245 missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23499519 missense probably benign
R6553:Kmt2e UTSW 5 23463026 missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23497581 missense possibly damaging 0.66
R6678:Kmt2e UTSW 5 23499295 missense possibly damaging 0.54
R6791:Kmt2e UTSW 5 23499476 intron probably benign
R6792:Kmt2e UTSW 5 23499476 intron probably benign
R6794:Kmt2e UTSW 5 23499476 intron probably benign
R6797:Kmt2e UTSW 5 23482507 missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23497545 missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23500487 missense possibly damaging 0.46
R7036:Kmt2e UTSW 5 23478743 missense probably null 1.00
R7173:Kmt2e UTSW 5 23464857 missense probably damaging 1.00
R7202:Kmt2e UTSW 5 23492294 unclassified probably benign
R7563:Kmt2e UTSW 5 23500273 missense probably damaging 1.00
R7571:Kmt2e UTSW 5 23478587 missense probably damaging 1.00
R7604:Kmt2e UTSW 5 23501765 missense not run
R7722:Kmt2e UTSW 5 23497018 missense probably benign 0.00
R7758:Kmt2e UTSW 5 23496070 missense possibly damaging 0.92
R7794:Kmt2e UTSW 5 23464716 missense probably damaging 1.00
R8137:Kmt2e UTSW 5 23501954 missense probably damaging 1.00
R8341:Kmt2e UTSW 5 23499453 missense probably damaging 0.98
R8383:Kmt2e UTSW 5 23485541 missense probably benign 0.08
R8400:Kmt2e UTSW 5 23497092 missense probably benign 0.17
R8750:Kmt2e UTSW 5 23493217 missense probably benign
R8786:Kmt2e UTSW 5 23464866 missense probably damaging 1.00
R9211:Kmt2e UTSW 5 23464772 missense possibly damaging 0.83
R9660:Kmt2e UTSW 5 23478619 missense probably damaging 1.00
R9786:Kmt2e UTSW 5 23497984 missense probably benign 0.16
RF026:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF028:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF040:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF042:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
Z1177:Kmt2e UTSW 5 23481208 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGTGCCCATATCAAATGCTTG -3'
(R):5'- ACCAGACACAGCTTATGGATAG -3'

Sequencing Primer
(F):5'- GCCCATATCAAATGCTTGCTTATTTC -3'
(R):5'- TATTGACAACAGAAAAACACTGGAC -3'
Posted On 2021-01-18