Incidental Mutation 'R8546:Irx6'
ID 659634
Institutional Source Beutler Lab
Gene Symbol Irx6
Ensembl Gene ENSMUSG00000031738
Gene Name Iroquois homeobox 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # R8546 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 92674288-92680956 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 92678636 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 377 (R377S)
Ref Sequence ENSEMBL: ENSMUSP00000034185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034185] [ENSMUST00000167261]
AlphaFold Q9ER75
Predicted Effect probably benign
Transcript: ENSMUST00000034185
AA Change: R377S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034185
Gene: ENSMUSG00000031738
AA Change: R377S

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
low complexity region 38 46 N/A INTRINSIC
HOX 143 208 1.76e-13 SMART
coiled coil region 247 280 N/A INTRINSIC
IRO 338 355 9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167261
AA Change: R377S

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127446
Gene: ENSMUSG00000031738
AA Change: R377S

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
low complexity region 38 46 N/A INTRINSIC
HOX 143 208 1.76e-13 SMART
coiled coil region 247 280 N/A INTRINSIC
IRO 338 355 9e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display abnormalities in retinal bipolar cell subtype identity and reduced electroretinography a and b wave amplitudes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A G 11: 101,990,861 R77G probably damaging Het
Acot1 T C 12: 84,017,365 S416P probably benign Het
Adcy9 G T 16: 4,418,905 A214E probably benign Het
Atp11a T A 8: 12,851,083 W971R probably damaging Het
Axl C T 7: 25,774,163 R346H probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cabin1 T C 10: 75,742,267 D532G probably damaging Het
Cdh20 A G 1: 104,934,044 probably benign Het
Clca3b T A 3: 144,827,397 S625C probably damaging Het
Col3a1 G A 1: 45,340,939 probably benign Het
Ctu2 T C 8: 122,479,363 L281P probably damaging Het
Cyb5a G A 18: 84,871,634 probably null Het
Cyb5rl T A 4: 107,068,726 V35D probably damaging Het
Dnah17 A G 11: 118,124,275 F381S probably benign Het
Eif3a A T 19: 60,766,770 N991K unknown Het
Eif6 A G 2: 155,826,500 probably benign Het
Fahd1 T C 17: 24,850,083 M7V possibly damaging Het
Fam171b A G 2: 83,855,451 T160A probably damaging Het
Fnip1 A G 11: 54,510,000 E1075G probably benign Het
Fras1 G A 5: 96,709,966 V2040I probably benign Het
Gjc2 G T 11: 59,176,356 D433E unknown Het
Gm14085 A T 2: 122,522,754 M472L probably benign Het
Hist1h2bl G A 13: 21,715,872 T91M probably damaging Het
Igsf9b T C 9: 27,333,130 S794P possibly damaging Het
Khnyn A G 14: 55,885,818 T10A probably benign Het
Kmt2e A T 5: 23,481,244 H389L probably damaging Het
Lin7c A G 2: 109,896,371 I122V probably null Het
Lonp1 G A 17: 56,626,702 P58S probably benign Het
Loxl4 T C 19: 42,607,588 H142R probably benign Het
Mcm6 C T 1: 128,345,948 E382K possibly damaging Het
Mettl2 T A 11: 105,131,573 N196K probably benign Het
Myo7b T C 18: 31,990,148 E712G probably benign Het
Ncam2 C T 16: 81,517,531 T465I probably benign Het
Olfr860 T A 9: 19,846,389 T77S probably damaging Het
Padi4 T C 4: 140,757,530 E340G probably damaging Het
Patj T A 4: 98,437,397 S490R probably benign Het
Pkd1l3 G A 8: 109,666,983 S1981N possibly damaging Het
Poll T A 19: 45,557,977 D208V probably damaging Het
Polr3f A G 2: 144,532,364 D64G probably damaging Het
Prkdc A G 16: 15,663,035 Y340C probably damaging Het
Prmt6 C T 3: 110,250,718 R85Q possibly damaging Het
Rgl3 T C 9: 21,987,860 K140R probably benign Het
Rhoj A G 12: 75,375,350 T61A probably benign Het
Skor1 T C 9: 63,142,288 D795G probably damaging Het
Tekt5 A G 16: 10,358,013 V556A probably benign Het
Tlr1 T A 5: 64,927,031 I68F probably damaging Het
Tnni3k G T 3: 154,792,807 N798K probably benign Het
Tuft1 T A 3: 94,622,113 E227D probably benign Het
Tulp1 T C 17: 28,363,736 K146R probably benign Het
Uhrf1bp1l A G 10: 89,794,535 N399S probably damaging Het
Usp24 G A 4: 106,402,129 A1616T probably benign Het
Ythdc1 A T 5: 86,826,748 K452N possibly damaging Het
Zscan4-ps3 T A 7: 11,612,770 H244Q possibly damaging Het
Other mutations in Irx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Irx6 APN 8 92676089 nonsense probably null
IGL02308:Irx6 APN 8 92677031 missense probably damaging 1.00
R0308:Irx6 UTSW 8 92677031 missense probably damaging 1.00
R1191:Irx6 UTSW 8 92676952 missense probably damaging 1.00
R1251:Irx6 UTSW 8 92678253 missense possibly damaging 0.87
R4161:Irx6 UTSW 8 92676291 missense possibly damaging 0.78
R4368:Irx6 UTSW 8 92678401 missense probably damaging 1.00
R4924:Irx6 UTSW 8 92678353 missense probably benign 0.25
R4950:Irx6 UTSW 8 92678800 missense probably damaging 1.00
R5425:Irx6 UTSW 8 92677517 critical splice donor site probably null
R6455:Irx6 UTSW 8 92676072 missense probably benign 0.04
R6969:Irx6 UTSW 8 92677330 missense probably damaging 1.00
R7019:Irx6 UTSW 8 92678734 missense probably damaging 0.99
R7128:Irx6 UTSW 8 92677366 missense probably damaging 1.00
R7133:Irx6 UTSW 8 92678413 missense probably damaging 1.00
R8182:Irx6 UTSW 8 92677014 nonsense probably null
R8955:Irx6 UTSW 8 92678412 missense probably damaging 1.00
Z1176:Irx6 UTSW 8 92678371 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTGACTTCATCACAGCAGAGC -3'
(R):5'- GGGTGCATATCTTTTGGACAAGC -3'

Sequencing Primer
(F):5'- TTCATCACAGCAGAGCCAGGC -3'
(R):5'- TTTGGACAAGCACTCTCAGCG -3'
Posted On 2021-01-18