Mutagenetix > Incidental Mutation

Incidental Mutation 'R8546:Cabin1'

659642

Institutional Source

Beutler Lab

Gene Symbol

Cabin1

Ensembl Gene

ENSMUSG00000020196

Gene Name

calcineurin binding protein 1

Synonyms

Cain, Ppp3in, A330070M20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8546 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75646112-75764341 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75742267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 532 (D532G)

Ref Sequence

ENSEMBL: ENSMUSP00000001712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001712]

AlphaFold

G3X8Q1

Predicted Effect

probably damaging
Transcript: ENSMUST00000001712
AA Change: D532G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000001712
Gene: ENSMUSG00000020196
AA Change: D532G

Domain	Start	End	E-Value	Type
low complexity region	61	71	N/A	INTRINSIC
TPR	90	123	4.15e-2	SMART
TPR	124	157	5.69e0	SMART
low complexity region	312	326	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
TPR	615	648	9.7e0	SMART
low complexity region	740	750	N/A	INTRINSIC
low complexity region	882	892	N/A	INTRINSIC
TPR	1055	1088	6.92e1	SMART
low complexity region	1327	1349	N/A	INTRINSIC
low complexity region	1714	1727	N/A	INTRINSIC
low complexity region	1778	1790	N/A	INTRINSIC
low complexity region	1791	1803	N/A	INTRINSIC
low complexity region	1810	1831	N/A	INTRINSIC
low complexity region	1941	1956	N/A	INTRINSIC
Pfam:MEF2_binding	2123	2157	5.7e-26	PFAM
low complexity region	2165	2183	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin plays an important role in the T-cell receptor-mediated signal transduction pathway. The protein encoded by this gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The encoded protein is found in the nucleus and contains a leucine zipper domain as well as several PEST motifs, sequences which confer targeted degradation to those proteins which contain them. Alternative splicing results in multiple transcript variants encoding two different isoforms. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mutants exhibit embryonic lethality during organogenesis. Mice producing a truncated protein exhibit elevated levels of serum IgG1, IgG2b and IgE, produce more IgG1 in response to T-cell dependent antigen, and have enhanced expression of cytokines in response to anti-CD3 stimulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	A	G	11: 101,990,861	R77G	probably damaging	Het
Acot1	T	C	12: 84,017,365	S416P	probably benign	Het
Adcy9	G	T	16: 4,418,905	A214E	probably benign	Het
Atp11a	T	A	8: 12,851,083	W971R	probably damaging	Het
Axl	C	T	7: 25,774,163	R346H	probably benign	Het
Bsn	G	A	9: 108,111,452	A2367V	probably benign	Het
Cdh20	A	G	1: 104,934,044		probably benign	Het
Clca3b	T	A	3: 144,827,397	S625C	probably damaging	Het
Col3a1	G	A	1: 45,340,939		probably benign	Het
Ctu2	T	C	8: 122,479,363	L281P	probably damaging	Het
Cyb5a	G	A	18: 84,871,634		probably null	Het
Cyb5rl	T	A	4: 107,068,726	V35D	probably damaging	Het
Dnah17	A	G	11: 118,124,275	F381S	probably benign	Het
Eif3a	A	T	19: 60,766,770	N991K	unknown	Het
Eif6	A	G	2: 155,826,500		probably benign	Het
Fahd1	T	C	17: 24,850,083	M7V	possibly damaging	Het
Fam171b	A	G	2: 83,855,451	T160A	probably damaging	Het
Fnip1	A	G	11: 54,510,000	E1075G	probably benign	Het
Fras1	G	A	5: 96,709,966	V2040I	probably benign	Het
Gjc2	G	T	11: 59,176,356	D433E	unknown	Het
Gm14085	A	T	2: 122,522,754	M472L	probably benign	Het
Hist1h2bl	G	A	13: 21,715,872	T91M	probably damaging	Het
Igsf9b	T	C	9: 27,333,130	S794P	possibly damaging	Het
Irx6	A	T	8: 92,678,636	R377S	probably benign	Het
Khnyn	A	G	14: 55,885,818	T10A	probably benign	Het
Kmt2e	A	T	5: 23,481,244	H389L	probably damaging	Het
Lin7c	A	G	2: 109,896,371	I122V	probably null	Het
Lonp1	G	A	17: 56,626,702	P58S	probably benign	Het
Loxl4	T	C	19: 42,607,588	H142R	probably benign	Het
Mcm6	C	T	1: 128,345,948	E382K	possibly damaging	Het
Mettl2	T	A	11: 105,131,573	N196K	probably benign	Het
Myo7b	T	C	18: 31,990,148	E712G	probably benign	Het
Ncam2	C	T	16: 81,517,531	T465I	probably benign	Het
Olfr860	T	A	9: 19,846,389	T77S	probably damaging	Het
Padi4	T	C	4: 140,757,530	E340G	probably damaging	Het
Patj	T	A	4: 98,437,397	S490R	probably benign	Het
Pkd1l3	G	A	8: 109,666,983	S1981N	possibly damaging	Het
Poll	T	A	19: 45,557,977	D208V	probably damaging	Het
Polr3f	A	G	2: 144,532,364	D64G	probably damaging	Het
Prkdc	A	G	16: 15,663,035	Y340C	probably damaging	Het
Prmt6	C	T	3: 110,250,718	R85Q	possibly damaging	Het
Rgl3	T	C	9: 21,987,860	K140R	probably benign	Het
Rhoj	A	G	12: 75,375,350	T61A	probably benign	Het
Skor1	T	C	9: 63,142,288	D795G	probably damaging	Het
Tekt5	A	G	16: 10,358,013	V556A	probably benign	Het
Tlr1	T	A	5: 64,927,031	I68F	probably damaging	Het
Tnni3k	G	T	3: 154,792,807	N798K	probably benign	Het
Tuft1	T	A	3: 94,622,113	E227D	probably benign	Het
Tulp1	T	C	17: 28,363,736	K146R	probably benign	Het
Uhrf1bp1l	A	G	10: 89,794,535	N399S	probably damaging	Het
Usp24	G	A	4: 106,402,129	A1616T	probably benign	Het
Ythdc1	A	T	5: 86,826,748	K452N	possibly damaging	Het
Zscan4-ps3	T	A	7: 11,612,770	H244Q	possibly damaging	Het

Other mutations in Cabin1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01434:Cabin1	APN	10	75725586	missense	possibly damaging	0.58
IGL01457:Cabin1	APN	10	75742429	missense	probably damaging	0.96
IGL02217:Cabin1	APN	10	75700047	missense	possibly damaging	0.95
IGL02649:Cabin1	APN	10	75737418	missense	probably damaging	1.00
IGL02737:Cabin1	APN	10	75713585	missense	probably benign	0.09
IGL02792:Cabin1	APN	10	75746739	missense	probably damaging	1.00
IGL03047:Cabin1	APN	10	75700100	splice site	probably benign
IGL03106:Cabin1	APN	10	75733628	missense	probably benign	0.01
IGL03276:Cabin1	APN	10	75732413	missense	probably damaging	1.00
bison	UTSW	10	75684323	missense	probably damaging	1.00
range	UTSW	10	75658647	missense	probably damaging	1.00
R0335:Cabin1	UTSW	10	75657049	missense	probably damaging	1.00
R0557:Cabin1	UTSW	10	75726917	missense	probably damaging	1.00
R0578:Cabin1	UTSW	10	75713610	missense	probably damaging	0.96
R0588:Cabin1	UTSW	10	75745337	missense	possibly damaging	0.71
R1115:Cabin1	UTSW	10	75717677	missense	possibly damaging	0.70
R1120:Cabin1	UTSW	10	75725716	missense	probably damaging	1.00
R1439:Cabin1	UTSW	10	75656806	missense	probably damaging	1.00
R1471:Cabin1	UTSW	10	75694792	missense	probably damaging	1.00
R1794:Cabin1	UTSW	10	75725745	missense	possibly damaging	0.52
R1844:Cabin1	UTSW	10	75743350	splice site	probably null
R1959:Cabin1	UTSW	10	75735090	missense	possibly damaging	0.92
R2008:Cabin1	UTSW	10	75734976	splice site	probably null
R2279:Cabin1	UTSW	10	75753461	missense	probably benign
R3150:Cabin1	UTSW	10	75656911	missense	probably damaging	1.00
R3929:Cabin1	UTSW	10	75751618	critical splice acceptor site	probably null
R3945:Cabin1	UTSW	10	75745259	missense	probably damaging	1.00
R3946:Cabin1	UTSW	10	75745259	missense	probably damaging	1.00
R4206:Cabin1	UTSW	10	75754841	missense	possibly damaging	0.69
R4812:Cabin1	UTSW	10	75646594	missense	possibly damaging	0.93
R4944:Cabin1	UTSW	10	75721363	missense	probably damaging	1.00
R4944:Cabin1	UTSW	10	75739421	missense	probably damaging	0.99
R5078:Cabin1	UTSW	10	75721478	missense	probably damaging	1.00
R5082:Cabin1	UTSW	10	75738330	missense	probably damaging	0.99
R5319:Cabin1	UTSW	10	75725715	missense	probably damaging	1.00
R5481:Cabin1	UTSW	10	75735066	missense	probably benign	0.29
R5504:Cabin1	UTSW	10	75653009	missense	probably benign	0.00
R5710:Cabin1	UTSW	10	75647018	missense	probably benign	0.00
R5908:Cabin1	UTSW	10	75721532	missense	probably damaging	1.00
R5975:Cabin1	UTSW	10	75657839	missense	probably damaging	1.00
R5982:Cabin1	UTSW	10	75725560	missense	probably benign	0.00
R6038:Cabin1	UTSW	10	75739366	missense	probably benign	0.02
R6038:Cabin1	UTSW	10	75739366	missense	probably benign	0.02
R6114:Cabin1	UTSW	10	75747971	missense	probably benign	0.00
R6285:Cabin1	UTSW	10	75684323	missense	probably damaging	1.00
R6341:Cabin1	UTSW	10	75658739	missense	probably damaging	0.98
R6361:Cabin1	UTSW	10	75726865	missense	possibly damaging	0.91
R6395:Cabin1	UTSW	10	75746742	missense	probably benign	0.10
R6422:Cabin1	UTSW	10	75656792	missense	probably damaging	1.00
R6575:Cabin1	UTSW	10	75725701	missense	possibly damaging	0.90
R6763:Cabin1	UTSW	10	75746730	missense	probably damaging	0.99
R6845:Cabin1	UTSW	10	75721508	missense	probably damaging	1.00
R6936:Cabin1	UTSW	10	75715758	splice site	probably null
R7050:Cabin1	UTSW	10	75713542	missense	probably damaging	1.00
R7055:Cabin1	UTSW	10	75743283	missense	probably benign	0.04
R7101:Cabin1	UTSW	10	75751567	missense	probably benign
R7138:Cabin1	UTSW	10	75745353	missense	probably damaging	0.98
R7173:Cabin1	UTSW	10	75746562	missense	probably benign	0.00
R7265:Cabin1	UTSW	10	75721423	missense
R7284:Cabin1	UTSW	10	75694834	missense
R7472:Cabin1	UTSW	10	75658647	missense	probably damaging	1.00
R7571:Cabin1	UTSW	10	75646666	missense	probably damaging	1.00
R7617:Cabin1	UTSW	10	75732443	missense	possibly damaging	0.85
R7739:Cabin1	UTSW	10	75658658	missense	probably damaging	1.00
R7997:Cabin1	UTSW	10	75733775	missense	probably benign	0.01
R8347:Cabin1	UTSW	10	75742367	missense	probably damaging	0.98
R8544:Cabin1	UTSW	10	75750056	missense	probably benign	0.17
R8692:Cabin1	UTSW	10	75751576	missense	probably benign	0.28
R8839:Cabin1	UTSW	10	75656816	missense	probably benign	0.00
R9010:Cabin1	UTSW	10	75735058	nonsense	probably null
R9108:Cabin1	UTSW	10	75657139	missense	possibly damaging	0.94
R9204:Cabin1	UTSW	10	75694716	missense	probably benign	0.01
R9259:Cabin1	UTSW	10	75746742	missense	probably benign
R9312:Cabin1	UTSW	10	75725735	missense	probably benign	0.07
R9421:Cabin1	UTSW	10	75657824	missense	probably damaging	1.00
R9439:Cabin1	UTSW	10	75745235	missense	probably damaging	1.00
R9578:Cabin1	UTSW	10	75754351	missense	probably damaging	0.99
R9645:Cabin1	UTSW	10	75658709	missense	probably benign	0.36
R9649:Cabin1	UTSW	10	75739405	missense	probably damaging	0.98
R9711:Cabin1	UTSW	10	75743256	missense	probably benign	0.02
Z1177:Cabin1	UTSW	10	75648123	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTGCCACTGATAGAACTGGC -3'
(R):5'- CATGCGTTCCTGATGGAGAACC -3'

Sequencing Primer
(F):5'- AGTACTCCATTCAGTCATTAGGGC -3'
(R):5'- TTCCTGATGGAGAACCTGACC -3'

Posted On

2021-01-18