Incidental Mutation 'R8546:Cabin1'
ID 659642
Institutional Source Beutler Lab
Gene Symbol Cabin1
Ensembl Gene ENSMUSG00000020196
Gene Name calcineurin binding protein 1
Synonyms A330070M20Rik, Ppp3in, Cain
MMRRC Submission 068511-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8546 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 75481946-75600175 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75578101 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 532 (D532G)
Ref Sequence ENSEMBL: ENSMUSP00000001712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001712]
AlphaFold G3X8Q1
Predicted Effect probably damaging
Transcript: ENSMUST00000001712
AA Change: D532G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001712
Gene: ENSMUSG00000020196
AA Change: D532G

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
TPR 90 123 4.15e-2 SMART
TPR 124 157 5.69e0 SMART
low complexity region 312 326 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
TPR 615 648 9.7e0 SMART
low complexity region 740 750 N/A INTRINSIC
low complexity region 882 892 N/A INTRINSIC
TPR 1055 1088 6.92e1 SMART
low complexity region 1327 1349 N/A INTRINSIC
low complexity region 1714 1727 N/A INTRINSIC
low complexity region 1778 1790 N/A INTRINSIC
low complexity region 1791 1803 N/A INTRINSIC
low complexity region 1810 1831 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Pfam:MEF2_binding 2123 2157 5.7e-26 PFAM
low complexity region 2165 2183 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin plays an important role in the T-cell receptor-mediated signal transduction pathway. The protein encoded by this gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The encoded protein is found in the nucleus and contains a leucine zipper domain as well as several PEST motifs, sequences which confer targeted degradation to those proteins which contain them. Alternative splicing results in multiple transcript variants encoding two different isoforms. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mutants exhibit embryonic lethality during organogenesis. Mice producing a truncated protein exhibit elevated levels of serum IgG1, IgG2b and IgE, produce more IgG1 in response to T-cell dependent antigen, and have enhanced expression of cytokines in response to anti-CD3 stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T C 12: 84,064,139 (GRCm39) S416P probably benign Het
Adcy9 G T 16: 4,236,769 (GRCm39) A214E probably benign Het
Atp11a T A 8: 12,901,083 (GRCm39) W971R probably damaging Het
Axl C T 7: 25,473,588 (GRCm39) R346H probably benign Het
Bltp3b A G 10: 89,630,397 (GRCm39) N399S probably damaging Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Cdh20 A G 1: 104,861,769 (GRCm39) probably benign Het
Cfap97d1 A G 11: 101,881,687 (GRCm39) R77G probably damaging Het
Clca3b T A 3: 144,533,158 (GRCm39) S625C probably damaging Het
Col3a1 G A 1: 45,380,099 (GRCm39) probably benign Het
Ctu2 T C 8: 123,206,102 (GRCm39) L281P probably damaging Het
Cyb5a G A 18: 84,889,759 (GRCm39) probably null Het
Cyb5rl T A 4: 106,925,923 (GRCm39) V35D probably damaging Het
Dnah17 A G 11: 118,015,101 (GRCm39) F381S probably benign Het
Eif3a A T 19: 60,755,208 (GRCm39) N991K unknown Het
Eif6 A G 2: 155,668,420 (GRCm39) probably benign Het
Fahd1 T C 17: 25,069,057 (GRCm39) M7V possibly damaging Het
Fam171b A G 2: 83,685,795 (GRCm39) T160A probably damaging Het
Fnip1 A G 11: 54,400,826 (GRCm39) E1075G probably benign Het
Fras1 G A 5: 96,857,825 (GRCm39) V2040I probably benign Het
Gjc2 G T 11: 59,067,182 (GRCm39) D433E unknown Het
H2bc13 G A 13: 21,900,042 (GRCm39) T91M probably damaging Het
Igsf9b T C 9: 27,244,426 (GRCm39) S794P possibly damaging Het
Irx6 A T 8: 93,405,264 (GRCm39) R377S probably benign Het
Khnyn A G 14: 56,123,275 (GRCm39) T10A probably benign Het
Kmt2e A T 5: 23,686,242 (GRCm39) H389L probably damaging Het
Lin7c A G 2: 109,726,716 (GRCm39) I122V probably null Het
Lonp1 G A 17: 56,933,702 (GRCm39) P58S probably benign Het
Loxl4 T C 19: 42,596,027 (GRCm39) H142R probably benign Het
Mcm6 C T 1: 128,273,685 (GRCm39) E382K possibly damaging Het
Mettl2 T A 11: 105,022,399 (GRCm39) N196K probably benign Het
Myo7b T C 18: 32,123,201 (GRCm39) E712G probably benign Het
Ncam2 C T 16: 81,314,419 (GRCm39) T465I probably benign Het
Or7e169 T A 9: 19,757,685 (GRCm39) T77S probably damaging Het
Padi4 T C 4: 140,484,841 (GRCm39) E340G probably damaging Het
Patj T A 4: 98,325,634 (GRCm39) S490R probably benign Het
Pkd1l3 G A 8: 110,393,615 (GRCm39) S1981N possibly damaging Het
Poll T A 19: 45,546,416 (GRCm39) D208V probably damaging Het
Polr3f A G 2: 144,374,284 (GRCm39) D64G probably damaging Het
Prkdc A G 16: 15,480,899 (GRCm39) Y340C probably damaging Het
Prmt6 C T 3: 110,158,034 (GRCm39) R85Q possibly damaging Het
Rgl3 T C 9: 21,899,156 (GRCm39) K140R probably benign Het
Rhoj A G 12: 75,422,124 (GRCm39) T61A probably benign Het
Skor1 T C 9: 63,049,570 (GRCm39) D795G probably damaging Het
Slc28a2b A T 2: 122,353,235 (GRCm39) M472L probably benign Het
Tekt5 A G 16: 10,175,877 (GRCm39) V556A probably benign Het
Tlr1 T A 5: 65,084,374 (GRCm39) I68F probably damaging Het
Tnni3k G T 3: 154,498,444 (GRCm39) N798K probably benign Het
Tuft1 T A 3: 94,529,420 (GRCm39) E227D probably benign Het
Tulp1 T C 17: 28,582,710 (GRCm39) K146R probably benign Het
Usp24 G A 4: 106,259,326 (GRCm39) A1616T probably benign Het
Ythdc1 A T 5: 86,974,607 (GRCm39) K452N possibly damaging Het
Zscan4-ps3 T A 7: 11,346,697 (GRCm39) H244Q possibly damaging Het
Other mutations in Cabin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Cabin1 APN 10 75,561,420 (GRCm39) missense possibly damaging 0.58
IGL01457:Cabin1 APN 10 75,578,263 (GRCm39) missense probably damaging 0.96
IGL02217:Cabin1 APN 10 75,535,881 (GRCm39) missense possibly damaging 0.95
IGL02649:Cabin1 APN 10 75,573,252 (GRCm39) missense probably damaging 1.00
IGL02737:Cabin1 APN 10 75,549,419 (GRCm39) missense probably benign 0.09
IGL02792:Cabin1 APN 10 75,582,573 (GRCm39) missense probably damaging 1.00
IGL03047:Cabin1 APN 10 75,535,934 (GRCm39) splice site probably benign
IGL03106:Cabin1 APN 10 75,569,462 (GRCm39) missense probably benign 0.01
IGL03276:Cabin1 APN 10 75,568,247 (GRCm39) missense probably damaging 1.00
bison UTSW 10 75,520,157 (GRCm39) missense probably damaging 1.00
range UTSW 10 75,494,481 (GRCm39) missense probably damaging 1.00
R0335:Cabin1 UTSW 10 75,492,883 (GRCm39) missense probably damaging 1.00
R0557:Cabin1 UTSW 10 75,562,751 (GRCm39) missense probably damaging 1.00
R0578:Cabin1 UTSW 10 75,549,444 (GRCm39) missense probably damaging 0.96
R0588:Cabin1 UTSW 10 75,581,171 (GRCm39) missense possibly damaging 0.71
R1115:Cabin1 UTSW 10 75,553,511 (GRCm39) missense possibly damaging 0.70
R1120:Cabin1 UTSW 10 75,561,550 (GRCm39) missense probably damaging 1.00
R1439:Cabin1 UTSW 10 75,492,640 (GRCm39) missense probably damaging 1.00
R1471:Cabin1 UTSW 10 75,530,626 (GRCm39) missense probably damaging 1.00
R1794:Cabin1 UTSW 10 75,561,579 (GRCm39) missense possibly damaging 0.52
R1844:Cabin1 UTSW 10 75,579,184 (GRCm39) splice site probably null
R1959:Cabin1 UTSW 10 75,570,924 (GRCm39) missense possibly damaging 0.92
R2008:Cabin1 UTSW 10 75,570,810 (GRCm39) splice site probably null
R2279:Cabin1 UTSW 10 75,589,295 (GRCm39) missense probably benign
R3150:Cabin1 UTSW 10 75,492,745 (GRCm39) missense probably damaging 1.00
R3929:Cabin1 UTSW 10 75,587,452 (GRCm39) critical splice acceptor site probably null
R3945:Cabin1 UTSW 10 75,581,093 (GRCm39) missense probably damaging 1.00
R3946:Cabin1 UTSW 10 75,581,093 (GRCm39) missense probably damaging 1.00
R4206:Cabin1 UTSW 10 75,590,675 (GRCm39) missense possibly damaging 0.69
R4812:Cabin1 UTSW 10 75,482,428 (GRCm39) missense possibly damaging 0.93
R4944:Cabin1 UTSW 10 75,575,255 (GRCm39) missense probably damaging 0.99
R4944:Cabin1 UTSW 10 75,557,197 (GRCm39) missense probably damaging 1.00
R5078:Cabin1 UTSW 10 75,557,312 (GRCm39) missense probably damaging 1.00
R5082:Cabin1 UTSW 10 75,574,164 (GRCm39) missense probably damaging 0.99
R5319:Cabin1 UTSW 10 75,561,549 (GRCm39) missense probably damaging 1.00
R5481:Cabin1 UTSW 10 75,570,900 (GRCm39) missense probably benign 0.29
R5504:Cabin1 UTSW 10 75,488,843 (GRCm39) missense probably benign 0.00
R5710:Cabin1 UTSW 10 75,482,852 (GRCm39) missense probably benign 0.00
R5908:Cabin1 UTSW 10 75,557,366 (GRCm39) missense probably damaging 1.00
R5975:Cabin1 UTSW 10 75,493,673 (GRCm39) missense probably damaging 1.00
R5982:Cabin1 UTSW 10 75,561,394 (GRCm39) missense probably benign 0.00
R6038:Cabin1 UTSW 10 75,575,200 (GRCm39) missense probably benign 0.02
R6038:Cabin1 UTSW 10 75,575,200 (GRCm39) missense probably benign 0.02
R6114:Cabin1 UTSW 10 75,583,805 (GRCm39) missense probably benign 0.00
R6285:Cabin1 UTSW 10 75,520,157 (GRCm39) missense probably damaging 1.00
R6341:Cabin1 UTSW 10 75,494,573 (GRCm39) missense probably damaging 0.98
R6361:Cabin1 UTSW 10 75,562,699 (GRCm39) missense possibly damaging 0.91
R6395:Cabin1 UTSW 10 75,582,576 (GRCm39) missense probably benign 0.10
R6422:Cabin1 UTSW 10 75,492,626 (GRCm39) missense probably damaging 1.00
R6575:Cabin1 UTSW 10 75,561,535 (GRCm39) missense possibly damaging 0.90
R6763:Cabin1 UTSW 10 75,582,564 (GRCm39) missense probably damaging 0.99
R6845:Cabin1 UTSW 10 75,557,342 (GRCm39) missense probably damaging 1.00
R6936:Cabin1 UTSW 10 75,551,592 (GRCm39) splice site probably null
R7050:Cabin1 UTSW 10 75,549,376 (GRCm39) missense probably damaging 1.00
R7055:Cabin1 UTSW 10 75,579,117 (GRCm39) missense probably benign 0.04
R7101:Cabin1 UTSW 10 75,587,401 (GRCm39) missense probably benign
R7138:Cabin1 UTSW 10 75,581,187 (GRCm39) missense probably damaging 0.98
R7173:Cabin1 UTSW 10 75,582,396 (GRCm39) missense probably benign 0.00
R7265:Cabin1 UTSW 10 75,557,257 (GRCm39) missense
R7284:Cabin1 UTSW 10 75,530,668 (GRCm39) missense
R7472:Cabin1 UTSW 10 75,494,481 (GRCm39) missense probably damaging 1.00
R7571:Cabin1 UTSW 10 75,482,500 (GRCm39) missense probably damaging 1.00
R7617:Cabin1 UTSW 10 75,568,277 (GRCm39) missense possibly damaging 0.85
R7739:Cabin1 UTSW 10 75,494,492 (GRCm39) missense probably damaging 1.00
R7997:Cabin1 UTSW 10 75,569,609 (GRCm39) missense probably benign 0.01
R8347:Cabin1 UTSW 10 75,578,201 (GRCm39) missense probably damaging 0.98
R8544:Cabin1 UTSW 10 75,585,890 (GRCm39) missense probably benign 0.17
R8692:Cabin1 UTSW 10 75,587,410 (GRCm39) missense probably benign 0.28
R8839:Cabin1 UTSW 10 75,492,650 (GRCm39) missense probably benign 0.00
R9010:Cabin1 UTSW 10 75,570,892 (GRCm39) nonsense probably null
R9108:Cabin1 UTSW 10 75,492,973 (GRCm39) missense possibly damaging 0.94
R9204:Cabin1 UTSW 10 75,530,550 (GRCm39) missense probably benign 0.01
R9259:Cabin1 UTSW 10 75,582,576 (GRCm39) missense probably benign
R9312:Cabin1 UTSW 10 75,561,569 (GRCm39) missense probably benign 0.07
R9421:Cabin1 UTSW 10 75,493,658 (GRCm39) missense probably damaging 1.00
R9439:Cabin1 UTSW 10 75,581,069 (GRCm39) missense probably damaging 1.00
R9578:Cabin1 UTSW 10 75,590,185 (GRCm39) missense probably damaging 0.99
R9645:Cabin1 UTSW 10 75,494,543 (GRCm39) missense probably benign 0.36
R9649:Cabin1 UTSW 10 75,575,239 (GRCm39) missense probably damaging 0.98
R9711:Cabin1 UTSW 10 75,579,090 (GRCm39) missense probably benign 0.02
Z1177:Cabin1 UTSW 10 75,483,957 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGCCACTGATAGAACTGGC -3'
(R):5'- CATGCGTTCCTGATGGAGAACC -3'

Sequencing Primer
(F):5'- AGTACTCCATTCAGTCATTAGGGC -3'
(R):5'- TTCCTGATGGAGAACCTGACC -3'
Posted On 2021-01-18