Incidental Mutation 'R8546:1700006E09Rik'
ID659646
Institutional Source Beutler Lab
Gene Symbol 1700006E09Rik
Ensembl Gene ENSMUSG00000010841
Gene NameRIKEN cDNA 1700006E09 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8546 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location101984279-101992264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101990861 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 77 (R77G)
Ref Sequence ENSEMBL: ENSMUSP00000134890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010985] [ENSMUST00000107172] [ENSMUST00000107173] [ENSMUST00000175972] [ENSMUST00000176722]
Predicted Effect probably damaging
Transcript: ENSMUST00000010985
AA Change: R128G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010985
Gene: ENSMUSG00000010841
AA Change: R128G

DomainStartEndE-ValueType
Pfam:KIAA1430 35 130 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107172
SMART Domains Protein: ENSMUSP00000102790
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107173
SMART Domains Protein: ENSMUSP00000102791
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 54 201 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175972
Predicted Effect probably damaging
Transcript: ENSMUST00000176722
AA Change: R77G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134890
Gene: ENSMUSG00000010841
AA Change: R77G

DomainStartEndE-ValueType
Pfam:KIAA1430 1 80 4.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T C 12: 84,017,365 S416P probably benign Het
Adcy9 G T 16: 4,418,905 A214E probably benign Het
Atp11a T A 8: 12,851,083 W971R probably damaging Het
Axl C T 7: 25,774,163 R346H probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cabin1 T C 10: 75,742,267 D532G probably damaging Het
Cdh20 A G 1: 104,934,044 probably benign Het
Clca3b T A 3: 144,827,397 S625C probably damaging Het
Col3a1 G A 1: 45,340,939 probably benign Het
Ctu2 T C 8: 122,479,363 L281P probably damaging Het
Cyb5a G A 18: 84,871,634 probably null Het
Cyb5rl T A 4: 107,068,726 V35D probably damaging Het
Dnah17 A G 11: 118,124,275 F381S probably benign Het
Eif3a A T 19: 60,766,770 N991K unknown Het
Eif6 A G 2: 155,826,500 probably benign Het
Fahd1 T C 17: 24,850,083 M7V possibly damaging Het
Fam171b A G 2: 83,855,451 T160A probably damaging Het
Fnip1 A G 11: 54,510,000 E1075G probably benign Het
Fras1 G A 5: 96,709,966 V2040I probably benign Het
Gjc2 G T 11: 59,176,356 D433E unknown Het
Gm14085 A T 2: 122,522,754 M472L probably benign Het
Hist1h2bl G A 13: 21,715,872 T91M probably damaging Het
Igsf9b T C 9: 27,333,130 S794P possibly damaging Het
Irx6 A T 8: 92,678,636 R377S probably benign Het
Khnyn A G 14: 55,885,818 T10A probably benign Het
Kmt2e A T 5: 23,481,244 H389L probably damaging Het
Lin7c A G 2: 109,896,371 I122V probably null Het
Lonp1 G A 17: 56,626,702 P58S probably benign Het
Loxl4 T C 19: 42,607,588 H142R probably benign Het
Mcm6 C T 1: 128,345,948 E382K possibly damaging Het
Mettl2 T A 11: 105,131,573 N196K probably benign Het
Myo7b T C 18: 31,990,148 E712G probably benign Het
Ncam2 C T 16: 81,517,531 T465I probably benign Het
Olfr860 T A 9: 19,846,389 T77S probably damaging Het
Padi4 T C 4: 140,757,530 E340G probably damaging Het
Patj T A 4: 98,437,397 S490R probably benign Het
Pkd1l3 G A 8: 109,666,983 S1981N possibly damaging Het
Poll T A 19: 45,557,977 D208V probably damaging Het
Polr3f A G 2: 144,532,364 D64G probably damaging Het
Prkdc A G 16: 15,663,035 Y340C probably damaging Het
Prmt6 C T 3: 110,250,718 R85Q possibly damaging Het
Rgl3 T C 9: 21,987,860 K140R probably benign Het
Rhoj A G 12: 75,375,350 T61A probably benign Het
Skor1 T C 9: 63,142,288 D795G probably damaging Het
Tekt5 A G 16: 10,358,013 V556A probably benign Het
Tlr1 T A 5: 64,927,031 I68F probably damaging Het
Tnni3k G T 3: 154,792,807 N798K probably benign Het
Tuft1 T A 3: 94,622,113 E227D probably benign Het
Tulp1 T C 17: 28,363,736 K146R probably benign Het
Uhrf1bp1l A G 10: 89,794,535 N399S probably damaging Het
Usp24 G A 4: 106,402,129 A1616T probably benign Het
Ythdc1 A T 5: 86,826,748 K452N possibly damaging Het
Zscan4-ps3 T A 7: 11,612,770 H244Q possibly damaging Het
Other mutations in 1700006E09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:1700006E09Rik APN 11 101990820 missense possibly damaging 0.75
IGL02442:1700006E09Rik APN 11 101990826 missense probably benign 0.00
R1802:1700006E09Rik UTSW 11 101988476 missense possibly damaging 0.56
R1937:1700006E09Rik UTSW 11 101987163 missense probably damaging 0.97
R2015:1700006E09Rik UTSW 11 101987218 missense probably damaging 1.00
R3732:1700006E09Rik UTSW 11 101988452 nonsense probably null
R3732:1700006E09Rik UTSW 11 101988452 nonsense probably null
R3733:1700006E09Rik UTSW 11 101988452 nonsense probably null
R3813:1700006E09Rik UTSW 11 101991488 missense probably benign 0.01
R5804:1700006E09Rik UTSW 11 101990814 missense probably damaging 1.00
R7351:1700006E09Rik UTSW 11 101991505 missense probably benign 0.01
R7451:1700006E09Rik UTSW 11 101991457 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCACTTGGTGTATTTCCCAGAATG -3'
(R):5'- GATACCTTTGGCCGTTCCAC -3'

Sequencing Primer
(F):5'- GGTGTATTTCCCAGAATGCACTGC -3'
(R):5'- ACAGTTTGCATCTGTGAGCTATGC -3'
Posted On2021-01-18