Incidental Mutation 'R8547:Lats1'
ID659692
Institutional Source Beutler Lab
Gene Symbol Lats1
Ensembl Gene ENSMUSG00000040021
Gene Namelarge tumor suppressor
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.810) question?
Stock #R8547 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location7681214-7716460 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7712849 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1077 (F1077L)
Ref Sequence ENSEMBL: ENSMUSP00000151533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]
Predicted Effect probably damaging
Transcript: ENSMUST00000040043
AA Change: F1077L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: F1077L

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165952
AA Change: F1077L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: F1077L

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217931
AA Change: F1077L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik A T 2: 23,230,123 Y177F probably damaging Het
Abca3 T C 17: 24,397,500 V972A probably benign Het
Adamts14 T G 10: 61,271,219 T41P probably damaging Het
Adamtsl3 C T 7: 82,428,413 T102I probably damaging Het
Ago3 T C 4: 126,370,316 I366V probably null Het
Aldh1a7 A G 19: 20,714,703 V242A possibly damaging Het
Asxl3 T C 18: 22,522,772 S1280P probably benign Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Caprin1 G T 2: 103,769,517 N604K probably damaging Het
Catsperb T C 12: 101,446,046 W131R probably damaging Het
Ccdc18 A G 5: 108,197,859 E957G probably damaging Het
Cd28 G A 1: 60,746,522 V17I probably benign Het
Cfl2 A T 12: 54,861,613 L75* probably null Het
Clspn T A 4: 126,561,816 L45H probably damaging Het
Col4a2 A G 8: 11,429,305 probably null Het
Dgka A T 10: 128,721,012 I663N probably damaging Het
Eppk1 C T 15: 76,109,049 V1211I probably benign Het
Fam193b A G 13: 55,550,304 S280P probably damaging Het
Fgd2 C T 17: 29,364,960 A116V probably damaging Het
Fmo5 C A 3: 97,651,495 Q424K probably benign Het
Fn3k T C 11: 121,450,161 L214P probably damaging Het
Gm3404 A T 5: 146,528,298 R283W possibly damaging Het
Gtdc1 A G 2: 44,788,981 probably benign Het
Hepacam T C 9: 37,367,753 I26T probably benign Het
Hltf T C 3: 20,098,127 F596L probably damaging Het
Ipo7 T G 7: 110,052,793 D926E probably benign Het
Krt16 G A 11: 100,246,257 Q463* probably null Het
Lrrc69 T C 4: 14,704,014 I269V probably benign Het
Mcm6 C T 1: 128,345,948 E382K possibly damaging Het
Npbwr1 A T 1: 5,917,227 C23S possibly damaging Het
Nsd3 T C 8: 25,694,784 C962R probably damaging Het
Nufip2 T C 11: 77,692,565 L435P probably damaging Het
Olfr382 T C 11: 73,516,614 N195S probably damaging Het
Olfr961 C T 9: 39,647,502 Q259* probably null Het
Psen1 T C 12: 83,714,856 V144A possibly damaging Het
Psmg2 T A 18: 67,646,007 S82T possibly damaging Het
Ptcd2 A C 13: 99,332,954 F154V probably damaging Het
Ptchd4 A C 17: 42,502,621 D471A probably benign Het
Robo4 C T 9: 37,404,378 T309I possibly damaging Het
Runx3 T C 4: 135,171,144 F209L probably damaging Het
Setd1a T C 7: 127,796,504 probably benign Het
Slc35g3 T C 11: 69,761,620 E22G probably benign Het
Spag9 T A 11: 94,122,821 M1303K possibly damaging Het
Ssh2 T A 11: 77,449,707 S562T probably benign Het
Tiparp T C 3: 65,546,377 probably null Het
Topbp1 C T 9: 103,336,065 P1028L probably benign Het
Unc45a A T 7: 80,326,092 L833Q possibly damaging Het
Vmn2r85 T C 10: 130,425,442 Y342C probably damaging Het
Vmn2r95 G A 17: 18,443,899 C460Y probably damaging Het
Vps13c T A 9: 67,945,566 I2376N probably damaging Het
Wisp3 T A 10: 39,151,198 D346V probably damaging Het
Zbtb21 C A 16: 97,952,115 A351S possibly damaging Het
Zzef1 T G 11: 72,844,441 Y623D probably damaging Het
Other mutations in Lats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lats1 APN 10 7691566 missense probably damaging 0.99
IGL00595:Lats1 APN 10 7702305 missense probably benign 0.00
IGL00932:Lats1 APN 10 7712742 missense possibly damaging 0.69
IGL01019:Lats1 APN 10 7705671 missense probably damaging 1.00
IGL01380:Lats1 APN 10 7691780 missense possibly damaging 0.69
IGL01965:Lats1 APN 10 7701706 missense probably benign 0.10
IGL02027:Lats1 APN 10 7712948 missense probably benign
IGL02611:Lats1 APN 10 7705787 missense possibly damaging 0.91
IGL02997:Lats1 APN 10 7702254 missense possibly damaging 0.53
IGL03107:Lats1 APN 10 7712746 missense probably benign 0.15
I1329:Lats1 UTSW 10 7712802 missense probably benign 0.10
PIT4378001:Lats1 UTSW 10 7705605 missense probably damaging 1.00
R0153:Lats1 UTSW 10 7691575 missense probably damaging 1.00
R0568:Lats1 UTSW 10 7712528 missense possibly damaging 0.69
R0581:Lats1 UTSW 10 7702941 missense possibly damaging 0.67
R0604:Lats1 UTSW 10 7712661 missense probably damaging 0.96
R1681:Lats1 UTSW 10 7705914 missense probably damaging 0.99
R1694:Lats1 UTSW 10 7701945 missense probably benign 0.07
R1840:Lats1 UTSW 10 7710939 nonsense probably null
R1914:Lats1 UTSW 10 7710457 splice site probably benign
R2137:Lats1 UTSW 10 7701847 missense possibly damaging 0.71
R2317:Lats1 UTSW 10 7691776 nonsense probably null
R3863:Lats1 UTSW 10 7705746 missense probably damaging 1.00
R3864:Lats1 UTSW 10 7705746 missense probably damaging 1.00
R4597:Lats1 UTSW 10 7691746 missense probably benign 0.00
R4657:Lats1 UTSW 10 7705684 missense possibly damaging 0.82
R4658:Lats1 UTSW 10 7702729 missense probably benign
R4663:Lats1 UTSW 10 7712583 missense probably damaging 1.00
R4870:Lats1 UTSW 10 7705785 missense probably damaging 1.00
R5101:Lats1 UTSW 10 7712584 nonsense probably null
R5134:Lats1 UTSW 10 7691811 missense probably benign 0.34
R5150:Lats1 UTSW 10 7712651 missense probably benign
R5546:Lats1 UTSW 10 7705754 missense probably damaging 0.99
R5820:Lats1 UTSW 10 7705908 missense probably damaging 1.00
R6006:Lats1 UTSW 10 7705595 missense probably damaging 1.00
R6301:Lats1 UTSW 10 7703107 missense probably benign 0.01
R6544:Lats1 UTSW 10 7701670 missense possibly damaging 0.94
R6647:Lats1 UTSW 10 7697507 missense possibly damaging 0.81
R6874:Lats1 UTSW 10 7710851 missense probably damaging 1.00
R7328:Lats1 UTSW 10 7705547 missense possibly damaging 0.62
R7390:Lats1 UTSW 10 7702095 nonsense probably null
R7438:Lats1 UTSW 10 7712942 nonsense probably null
R7457:Lats1 UTSW 10 7710891 missense probably damaging 1.00
R7524:Lats1 UTSW 10 7701978 missense possibly damaging 0.89
R7593:Lats1 UTSW 10 7701712 missense probably damaging 1.00
R7736:Lats1 UTSW 10 7702364 missense probably damaging 1.00
R7884:Lats1 UTSW 10 7697526 nonsense probably null
R8166:Lats1 UTSW 10 7702116 missense probably benign
R8248:Lats1 UTSW 10 7705903 missense probably damaging 1.00
R8458:Lats1 UTSW 10 7710924 nonsense probably null
R8477:Lats1 UTSW 10 7705515 missense probably damaging 1.00
RF021:Lats1 UTSW 10 7710608 missense probably damaging 1.00
X0026:Lats1 UTSW 10 7710623 missense probably damaging 1.00
X0053:Lats1 UTSW 10 7691609 missense probably benign 0.00
Z1176:Lats1 UTSW 10 7705809 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGATTTCTCTAGTGATCTGAGAC -3'
(R):5'- ACTTCAGGCCTCTTGCAAATTC -3'

Sequencing Primer
(F):5'- CTCTAGTGATCTGAGACAGCAGTC -3'
(R):5'- CAGGCCTCTTGCAAATTCTTACAATG -3'
Posted On2021-01-18