Incidental Mutation 'R8547:Fgd2'
ID 659714
Institutional Source Beutler Lab
Gene Symbol Fgd2
Ensembl Gene ENSMUSG00000024013
Gene Name FYVE, RhoGEF and PH domain containing 2
Synonyms Tcd-2, tcs2, Tcd2, tcs-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock # R8547 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 29360914-29379660 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 29364960 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 116 (A116V)
Ref Sequence ENSEMBL: ENSMUSP00000118828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024810] [ENSMUST00000123989]
AlphaFold Q8BY35
Predicted Effect probably damaging
Transcript: ENSMUST00000024810
AA Change: A116V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024810
Gene: ENSMUSG00000024013
AA Change: A116V

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
PH 320 420 2.09e-16 SMART
FYVE 450 519 1.07e-28 SMART
PH 545 643 5.09e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123989
AA Change: A116V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118828
Gene: ENSMUSG00000024013
AA Change: A116V

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of guanine nucleotide exchange factors (GEFs) which control cytoskeleton-dependent membrane rearrangements by activating the cell division cycle 42 (CDC42) protein. This gene is expressed in B lymphocytes, macrophages, and dendritic cells. The encoded protein may play a role in leukocyte signaling and vesicle trafficking in antigen-presenting cells in the immune system. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik A T 2: 23,230,123 Y177F probably damaging Het
Abca3 T C 17: 24,397,500 V972A probably benign Het
Adamts14 T G 10: 61,271,219 T41P probably damaging Het
Adamtsl3 C T 7: 82,428,413 T102I probably damaging Het
Ago3 T C 4: 126,370,316 I366V probably null Het
Aldh1a7 A G 19: 20,714,703 V242A possibly damaging Het
Asxl3 T C 18: 22,522,772 S1280P probably benign Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Caprin1 G T 2: 103,769,517 N604K probably damaging Het
Catsperb T C 12: 101,446,046 W131R probably damaging Het
Ccdc18 A G 5: 108,197,859 E957G probably damaging Het
Cd28 G A 1: 60,746,522 V17I probably benign Het
Cfl2 A T 12: 54,861,613 L75* probably null Het
Clspn T A 4: 126,561,816 L45H probably damaging Het
Col4a2 A G 8: 11,429,305 probably null Het
Dgka A T 10: 128,721,012 I663N probably damaging Het
Eppk1 C T 15: 76,109,049 V1211I probably benign Het
Fam193b A G 13: 55,550,304 S280P probably damaging Het
Fmo5 C A 3: 97,651,495 Q424K probably benign Het
Fn3k T C 11: 121,450,161 L214P probably damaging Het
Gm3404 A T 5: 146,528,298 R283W possibly damaging Het
Gtdc1 A G 2: 44,788,981 probably benign Het
Hepacam T C 9: 37,367,753 I26T probably benign Het
Hltf T C 3: 20,098,127 F596L probably damaging Het
Ipo7 T G 7: 110,052,793 D926E probably benign Het
Krt16 G A 11: 100,246,257 Q463* probably null Het
Lats1 T C 10: 7,712,849 F1077L probably damaging Het
Lrrc69 T C 4: 14,704,014 I269V probably benign Het
Mcm6 C T 1: 128,345,948 E382K possibly damaging Het
Npbwr1 A T 1: 5,917,227 C23S possibly damaging Het
Nsd3 T C 8: 25,694,784 C962R probably damaging Het
Nufip2 T C 11: 77,692,565 L435P probably damaging Het
Olfr382 T C 11: 73,516,614 N195S probably damaging Het
Olfr961 C T 9: 39,647,502 Q259* probably null Het
Psen1 T C 12: 83,714,856 V144A possibly damaging Het
Psmg2 T A 18: 67,646,007 S82T possibly damaging Het
Ptcd2 A C 13: 99,332,954 F154V probably damaging Het
Ptchd4 A C 17: 42,502,621 D471A probably benign Het
Robo4 C T 9: 37,404,378 T309I possibly damaging Het
Runx3 T C 4: 135,171,144 F209L probably damaging Het
Setd1a T C 7: 127,796,504 probably benign Het
Slc35g3 T C 11: 69,761,620 E22G probably benign Het
Spag9 T A 11: 94,122,821 M1303K possibly damaging Het
Ssh2 T A 11: 77,449,707 S562T probably benign Het
Tiparp T C 3: 65,546,377 probably null Het
Topbp1 C T 9: 103,336,065 P1028L probably benign Het
Unc45a A T 7: 80,326,092 L833Q possibly damaging Het
Vmn2r85 T C 10: 130,425,442 Y342C probably damaging Het
Vmn2r95 G A 17: 18,443,899 C460Y probably damaging Het
Vps13c T A 9: 67,945,566 I2376N probably damaging Het
Wisp3 T A 10: 39,151,198 D346V probably damaging Het
Zbtb21 C A 16: 97,952,115 A351S possibly damaging Het
Zzef1 T G 11: 72,844,441 Y623D probably damaging Het
Other mutations in Fgd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Fgd2 APN 17 29367975 missense probably damaging 1.00
IGL01505:Fgd2 APN 17 29366997 missense probably damaging 1.00
IGL03240:Fgd2 APN 17 29361161 splice site probably benign
ceci UTSW 17 29368376 splice site probably null
R0046:Fgd2 UTSW 17 29374990 splice site probably benign
R0271:Fgd2 UTSW 17 29367008 missense possibly damaging 0.94
R0594:Fgd2 UTSW 17 29365552 missense probably damaging 1.00
R0612:Fgd2 UTSW 17 29378347 missense probably benign 0.45
R1470:Fgd2 UTSW 17 29374108 splice site probably benign
R1551:Fgd2 UTSW 17 29378409 missense probably damaging 1.00
R1596:Fgd2 UTSW 17 29376930 missense probably benign 0.43
R1664:Fgd2 UTSW 17 29369299 missense probably damaging 1.00
R1689:Fgd2 UTSW 17 29363722 missense probably benign
R1691:Fgd2 UTSW 17 29378944 nonsense probably null
R1695:Fgd2 UTSW 17 29368245 missense possibly damaging 0.88
R2697:Fgd2 UTSW 17 29376921 missense probably damaging 1.00
R3500:Fgd2 UTSW 17 29365601 missense possibly damaging 0.74
R3689:Fgd2 UTSW 17 29378950 missense probably benign 0.00
R4583:Fgd2 UTSW 17 29367078 missense possibly damaging 0.87
R4871:Fgd2 UTSW 17 29373249 missense possibly damaging 0.89
R5011:Fgd2 UTSW 17 29374980 critical splice donor site probably null
R5209:Fgd2 UTSW 17 29368376 splice site probably null
R7106:Fgd2 UTSW 17 29376970 nonsense probably null
R7139:Fgd2 UTSW 17 29373255 missense probably damaging 1.00
R7712:Fgd2 UTSW 17 29376912 missense probably benign 0.01
R7833:Fgd2 UTSW 17 29367395 missense possibly damaging 0.81
R7834:Fgd2 UTSW 17 29364951 missense probably damaging 1.00
R7913:Fgd2 UTSW 17 29374045 missense probably damaging 1.00
R8686:Fgd2 UTSW 17 29379023 missense probably benign
R9088:Fgd2 UTSW 17 29364939 missense probably damaging 1.00
R9525:Fgd2 UTSW 17 29364981 missense probably damaging 1.00
Z1177:Fgd2 UTSW 17 29378326 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTATGAAAGCTGGTCCAGTG -3'
(R):5'- CAAACGAGGCTGCCATGTATG -3'

Sequencing Primer
(F):5'- AAAGCTGGTCCAGTGCCAGAC -3'
(R):5'- CATGTATGAGGCTGGCCAG -3'
Posted On 2021-01-18