Incidental Mutation 'R8548:Nmt1'
ID 659751
Institutional Source Beutler Lab
Gene Symbol Nmt1
Ensembl Gene ENSMUSG00000020936
Gene Name N-myristoyltransferase 1
Synonyms
MMRRC Submission 068513-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8548 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 103028190-103068912 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103043226 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 64 (K64E)
Ref Sequence ENSEMBL: ENSMUSP00000021314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021314]
AlphaFold O70310
Predicted Effect possibly damaging
Transcript: ENSMUST00000021314
AA Change: K64E

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021314
Gene: ENSMUSG00000020936
AA Change: K64E

DomainStartEndE-ValueType
low complexity region 55 67 N/A INTRINSIC
Pfam:NMT 137 294 6.7e-77 PFAM
Pfam:NMT_C 308 495 1.4e-85 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myristate, a rare 14-carbon saturated fatty acid, is cotranslationally attached by an amide linkage to the N-terminal glycine residue of cellular and viral proteins with diverse functions. N-myristoyltransferase (NMT; EC 2.3.1.97) catalyzes the transfer of myristate from CoA to proteins. N-myristoylation appears to be irreversible and is required for full expression of the biologic activities of several N-myristoylated proteins, including the alpha subunit of the signal-transducing guanine nucleotide-binding protein (G protein) GO (GNAO1; MIM 139311) (Duronio et al., 1992 [PubMed 1570339]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5 and E7.5. Heterozygotes show partial prenatal lethality. Mice homozygous for a conditional allele knocked out in T cells exhibit reduced T cell, double positive T cell and single positive T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a A T 5: 121,520,102 L376Q probably damaging Het
Akirin1 A G 4: 123,738,038 M179T possibly damaging Het
Ap5b1 G T 19: 5,571,095 V848L possibly damaging Het
Apoa2 T A 1: 171,226,229 M91K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cdc20 A C 4: 118,436,338 S160A possibly damaging Het
Cftr G T 6: 18,273,699 V839L possibly damaging Het
Ctf1 A T 7: 127,717,392 H171L probably benign Het
Dmac2 T A 7: 25,624,792 M225K probably damaging Het
Dmbx1 A T 4: 115,920,315 V112E probably damaging Het
Eloa T C 4: 136,005,677 K754R probably damaging Het
Ern2 G A 7: 122,177,839 T286I probably damaging Het
Fam135b T C 15: 71,462,810 D845G probably damaging Het
Fbxl6 T A 15: 76,537,342 M232L possibly damaging Het
Gpr171 A T 3: 59,097,979 I125K probably damaging Het
Hoxa2 G A 6: 52,163,118 T296I probably damaging Het
Hspa8 A G 9: 40,802,471 M87V probably benign Het
Ilkap G T 1: 91,391,160 D31E possibly damaging Het
Ints9 T C 14: 65,032,321 S487P probably benign Het
Macc1 T A 12: 119,450,356 S756T probably benign Het
Map2 A G 1: 66,413,340 D545G probably damaging Het
Mapkbp1 A G 2: 120,024,091 N1390D probably benign Het
Mgat5 G A 1: 127,320,672 V104M possibly damaging Het
Myoz2 T A 3: 123,034,267 M1L possibly damaging Het
Nr6a1 C A 2: 38,729,538 Q448H probably damaging Het
Nr6a1 T G 2: 38,729,539 Q448P probably damaging Het
Odf2 T C 2: 29,893,514 probably null Het
Olfr970 T A 9: 39,820,241 C201S probably benign Het
Osbpl6 A G 2: 76,579,222 N476S possibly damaging Het
Pclo A G 5: 14,682,254 probably null Het
Plxnd1 C T 6: 115,957,597 D1792N probably damaging Het
Prdm11 C T 2: 93,012,758 V119M probably damaging Het
Prss23 A G 7: 89,510,208 F218L probably benign Het
Rflnb A G 11: 76,022,221 Y114H probably damaging Het
Skor2 T A 18: 76,858,886 I101N unknown Het
Sp8 A C 12: 118,849,175 Y255S possibly damaging Het
Srfbp1 G A 18: 52,488,391 V175I probably benign Het
Stxbp5 C T 10: 9,817,306 D359N probably null Het
Thnsl1 A G 2: 21,212,922 I496V possibly damaging Het
Usp32 G A 11: 85,017,827 P1018S possibly damaging Het
Usp7 A T 16: 8,712,075 V142E possibly damaging Het
Other mutations in Nmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Nmt1 APN 11 103060076 critical splice acceptor site probably null
IGL02058:Nmt1 APN 11 103052290 missense probably benign 0.00
IGL02582:Nmt1 APN 11 103064799 missense possibly damaging 0.94
cropped UTSW 11 103056459 missense probably damaging 1.00
R0092:Nmt1 UTSW 11 103046493 missense probably damaging 1.00
R1401:Nmt1 UTSW 11 103057481 missense probably damaging 0.99
R1827:Nmt1 UTSW 11 103064838 missense probably damaging 1.00
R1878:Nmt1 UTSW 11 103052251 missense probably benign
R2199:Nmt1 UTSW 11 103063856 missense probably damaging 1.00
R3930:Nmt1 UTSW 11 103052233 missense probably benign 0.37
R4373:Nmt1 UTSW 11 103043200 missense probably damaging 0.99
R4648:Nmt1 UTSW 11 103063917 missense probably damaging 1.00
R5666:Nmt1 UTSW 11 103058215 nonsense probably null
R6908:Nmt1 UTSW 11 103058254 missense possibly damaging 0.92
R7315:Nmt1 UTSW 11 103060183 missense probably benign
R7473:Nmt1 UTSW 11 103046400 missense probably benign 0.05
R7504:Nmt1 UTSW 11 103056459 missense probably damaging 1.00
R8913:Nmt1 UTSW 11 103057445 missense probably damaging 1.00
X0018:Nmt1 UTSW 11 103028586 missense probably benign 0.01
Z1177:Nmt1 UTSW 11 103055213 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTCTGAAGCAGCCAACAGAC -3'
(R):5'- GTACCGAGCACAGTTTCATCAAC -3'

Sequencing Primer
(F):5'- CAGACTTGATTAAGGAAGGTCTGCTC -3'
(R):5'- GTTTCATCAACAAAGTCTAAGGCAC -3'
Posted On 2021-01-18