Incidental Mutation 'R8548:Fbxl6'
ID 659756
Institutional Source Beutler Lab
Gene Symbol Fbxl6
Ensembl Gene ENSMUSG00000022559
Gene Name F-box and leucine-rich repeat protein 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R8548 (G1)
Quality Score 204.009
Status Not validated
Chromosome 15
Chromosomal Location 76535721-76538746 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76537342 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 232 (M232L)
Ref Sequence ENSEMBL: ENSMUSP00000023219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220] [ENSMUST00000230604]
AlphaFold Q9QXW0
Predicted Effect possibly damaging
Transcript: ENSMUST00000023219
AA Change: M232L

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559
AA Change: M232L

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 58 77 N/A INTRINSIC
Pfam:F-box 104 154 3.1e-6 PFAM
Pfam:F-box-like 105 155 1.8e-13 PFAM
low complexity region 163 174 N/A INTRINSIC
SCOP:d1yrga_ 184 448 3e-9 SMART
Blast:LRR 211 236 2e-6 BLAST
Blast:LRR 347 373 6e-8 BLAST
Blast:LRR 375 405 7e-9 BLAST
Blast:LRR 432 456 7e-6 BLAST
Blast:LRR 464 488 1e-5 BLAST
Blast:LRR 489 520 7e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000023220
SMART Domains Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 201 223 N/A INTRINSIC
Pfam:DUF1011 278 376 3e-38 PFAM
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230604
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are characterized by an F-box motif. The encoded protein also contains leucine-rich repeats. F-box-containing proteins comprise one of the subunits of the SCF (SKP1-cullin-F-box) complex, which functions in phosphorylation-dependent ubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a A T 5: 121,520,102 L376Q probably damaging Het
Akirin1 A G 4: 123,738,038 M179T possibly damaging Het
Ap5b1 G T 19: 5,571,095 V848L possibly damaging Het
Apoa2 T A 1: 171,226,229 M91K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cdc20 A C 4: 118,436,338 S160A possibly damaging Het
Cftr G T 6: 18,273,699 V839L possibly damaging Het
Ctf1 A T 7: 127,717,392 H171L probably benign Het
Dmac2 T A 7: 25,624,792 M225K probably damaging Het
Dmbx1 A T 4: 115,920,315 V112E probably damaging Het
Eloa T C 4: 136,005,677 K754R probably damaging Het
Ern2 G A 7: 122,177,839 T286I probably damaging Het
Fam135b T C 15: 71,462,810 D845G probably damaging Het
Gpr171 A T 3: 59,097,979 I125K probably damaging Het
Hoxa2 G A 6: 52,163,118 T296I probably damaging Het
Hspa8 A G 9: 40,802,471 M87V probably benign Het
Ilkap G T 1: 91,391,160 D31E possibly damaging Het
Ints9 T C 14: 65,032,321 S487P probably benign Het
Macc1 T A 12: 119,450,356 S756T probably benign Het
Map2 A G 1: 66,413,340 D545G probably damaging Het
Mapkbp1 A G 2: 120,024,091 N1390D probably benign Het
Mgat5 G A 1: 127,320,672 V104M possibly damaging Het
Myoz2 T A 3: 123,034,267 M1L possibly damaging Het
Nmt1 A G 11: 103,043,226 K64E possibly damaging Het
Nr6a1 C A 2: 38,729,538 Q448H probably damaging Het
Nr6a1 T G 2: 38,729,539 Q448P probably damaging Het
Odf2 T C 2: 29,893,514 probably null Het
Olfr970 T A 9: 39,820,241 C201S probably benign Het
Osbpl6 A G 2: 76,579,222 N476S possibly damaging Het
Pclo A G 5: 14,682,254 probably null Het
Plxnd1 C T 6: 115,957,597 D1792N probably damaging Het
Prdm11 C T 2: 93,012,758 V119M probably damaging Het
Prss23 A G 7: 89,510,208 F218L probably benign Het
Rflnb A G 11: 76,022,221 Y114H probably damaging Het
Skor2 T A 18: 76,858,886 I101N unknown Het
Sp8 A C 12: 118,849,175 Y255S possibly damaging Het
Srfbp1 G A 18: 52,488,391 V175I probably benign Het
Stxbp5 C T 10: 9,817,306 D359N probably null Het
Thnsl1 A G 2: 21,212,922 I496V possibly damaging Het
Usp32 G A 11: 85,017,827 P1018S possibly damaging Het
Usp7 A T 16: 8,712,075 V142E possibly damaging Het
Other mutations in Fbxl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Fbxl6 APN 15 76535906 nonsense probably null
IGL02205:Fbxl6 APN 15 76537341 missense probably benign 0.05
R0244:Fbxl6 UTSW 15 76537191 missense probably damaging 1.00
R0449:Fbxl6 UTSW 15 76535955 missense probably damaging 1.00
R0608:Fbxl6 UTSW 15 76536753 missense probably benign 0.04
R0904:Fbxl6 UTSW 15 76537083 splice site probably null
R1477:Fbxl6 UTSW 15 76537734 missense probably benign
R1784:Fbxl6 UTSW 15 76538058 missense probably damaging 1.00
R2109:Fbxl6 UTSW 15 76536973 missense probably damaging 0.99
R3937:Fbxl6 UTSW 15 76536624 nonsense probably null
R4414:Fbxl6 UTSW 15 76537724 missense possibly damaging 0.76
R4416:Fbxl6 UTSW 15 76537724 missense possibly damaging 0.76
R4483:Fbxl6 UTSW 15 76537929 missense probably damaging 1.00
R4835:Fbxl6 UTSW 15 76536804 missense probably damaging 1.00
R6175:Fbxl6 UTSW 15 76538433 missense probably benign
R6345:Fbxl6 UTSW 15 76535854 missense probably damaging 1.00
R6750:Fbxl6 UTSW 15 76538412 missense probably damaging 1.00
R6800:Fbxl6 UTSW 15 76538698 unclassified probably benign
R7485:Fbxl6 UTSW 15 76537913 splice site probably null
R7560:Fbxl6 UTSW 15 76538469 missense probably benign 0.06
R7726:Fbxl6 UTSW 15 76535886 missense probably damaging 1.00
R7811:Fbxl6 UTSW 15 76537285 splice site probably null
R8353:Fbxl6 UTSW 15 76538478 missense probably benign 0.06
X0058:Fbxl6 UTSW 15 76538476 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCGTCTGGGAACTGTAGGTC -3'
(R):5'- TTGTCATGACTACCAGTGTCCC -3'

Sequencing Primer
(F):5'- ACAGTTTACGCATTCGGGAC -3'
(R):5'- GACTACCAGTGTCCCTGTAGATAG -3'
Posted On 2021-01-18