Incidental Mutation 'R8548:Ap5b1'
ID659760
Institutional Source Beutler Lab
Gene Symbol Ap5b1
Ensembl Gene ENSMUSG00000049562
Gene Nameadaptor-related protein complex 5, beta 1 subunit
SynonymsGm962
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R8548 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location5568074-5571261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5571095 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 848 (V848L)
Ref Sequence ENSEMBL: ENSMUSP00000094042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096318
AA Change: V848L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000094042
Gene: ENSMUSG00000049562
AA Change: V848L

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 68 75 N/A INTRINSIC
low complexity region 84 104 N/A INTRINSIC
low complexity region 114 136 N/A INTRINSIC
low complexity region 185 199 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
low complexity region 511 524 N/A INTRINSIC
low complexity region 616 644 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a A T 5: 121,520,102 L376Q probably damaging Het
Akirin1 A G 4: 123,738,038 M179T possibly damaging Het
Apoa2 T A 1: 171,226,229 M91K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cdc20 A C 4: 118,436,338 S160A possibly damaging Het
Cftr G T 6: 18,273,699 V839L possibly damaging Het
Ctf1 A T 7: 127,717,392 H171L probably benign Het
Dmac2 T A 7: 25,624,792 M225K probably damaging Het
Dmbx1 A T 4: 115,920,315 V112E probably damaging Het
Eloa T C 4: 136,005,677 K754R probably damaging Het
Ern2 G A 7: 122,177,839 T286I probably damaging Het
Fam135b T C 15: 71,462,810 D845G probably damaging Het
Fbxl6 T A 15: 76,537,342 M232L possibly damaging Het
Gpr171 A T 3: 59,097,979 I125K probably damaging Het
Hoxa2 G A 6: 52,163,118 T296I probably damaging Het
Hspa8 A G 9: 40,802,471 M87V probably benign Het
Ilkap G T 1: 91,391,160 D31E possibly damaging Het
Ints9 T C 14: 65,032,321 S487P probably benign Het
Macc1 T A 12: 119,450,356 S756T probably benign Het
Map2 A G 1: 66,413,340 D545G probably damaging Het
Mapkbp1 A G 2: 120,024,091 N1390D probably benign Het
Mgat5 G A 1: 127,320,672 V104M possibly damaging Het
Myoz2 T A 3: 123,034,267 M1L possibly damaging Het
Nmt1 A G 11: 103,043,226 K64E possibly damaging Het
Nr6a1 C A 2: 38,729,538 Q448H probably damaging Het
Nr6a1 T G 2: 38,729,539 Q448P probably damaging Het
Odf2 T C 2: 29,893,514 probably null Het
Olfr970 T A 9: 39,820,241 C201S probably benign Het
Osbpl6 A G 2: 76,579,222 N476S possibly damaging Het
Pclo A G 5: 14,682,254 probably null Het
Plxnd1 C T 6: 115,957,597 D1792N probably damaging Het
Prdm11 C T 2: 93,012,758 V119M probably damaging Het
Prss23 A G 7: 89,510,208 F218L probably benign Het
Rflnb A G 11: 76,022,221 Y114H probably damaging Het
Skor2 T A 18: 76,858,886 I101N unknown Het
Sp8 A C 12: 118,849,175 Y255S possibly damaging Het
Srfbp1 G A 18: 52,488,391 V175I probably benign Het
Stxbp5 C T 10: 9,817,306 D359N probably null Het
Thnsl1 A G 2: 21,212,922 I496V possibly damaging Het
Usp32 G A 11: 85,017,827 P1018S possibly damaging Het
Usp7 A T 16: 8,712,075 V142E possibly damaging Het
Other mutations in Ap5b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01906:Ap5b1 APN 19 5570979 nonsense probably null
IGL02121:Ap5b1 APN 19 5570787 missense possibly damaging 0.92
R1513:Ap5b1 UTSW 19 5569864 nonsense probably null
R2004:Ap5b1 UTSW 19 5570474 missense possibly damaging 0.83
R2036:Ap5b1 UTSW 19 5568869 missense possibly damaging 0.83
R2282:Ap5b1 UTSW 19 5569637 missense possibly damaging 0.66
R3441:Ap5b1 UTSW 19 5569983 missense probably benign
R3835:Ap5b1 UTSW 19 5568890 missense possibly damaging 0.66
R4241:Ap5b1 UTSW 19 5568797 missense possibly damaging 0.92
R5324:Ap5b1 UTSW 19 5569835 missense possibly damaging 0.66
R5359:Ap5b1 UTSW 19 5569098 missense possibly damaging 0.83
R7102:Ap5b1 UTSW 19 5570187 missense possibly damaging 0.92
R7132:Ap5b1 UTSW 19 5569384 nonsense probably null
Z1088:Ap5b1 UTSW 19 5570424 missense possibly damaging 0.82
Z1177:Ap5b1 UTSW 19 5570928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGATGAGCTCTGGAACTCC -3'
(R):5'- GTCTGCTCCAAAAGAAAACAGG -3'

Sequencing Primer
(F):5'- TGGAACTCCTGCCTACCAAAGG -3'
(R):5'- GCCAGGAGGAGTAGTCTGTG -3'
Posted On2021-01-18