Incidental Mutation 'R8549:Cyp39a1'
ID 659798
Institutional Source Beutler Lab
Gene Symbol Cyp39a1
Ensembl Gene ENSMUSG00000023963
Gene Name cytochrome P450, family 39, subfamily a, polypeptide 1
Synonyms oxysterol 7-alpha-hydroxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8549 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 43667425-43751431 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43730995 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 364 (D364E)
Ref Sequence ENSEMBL: ENSMUSP00000130073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170988]
AlphaFold Q9JKJ9
Predicted Effect possibly damaging
Transcript: ENSMUST00000170988
AA Change: D364E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130073
Gene: ENSMUSG00000023963
AA Change: D364E

DomainStartEndE-ValueType
Pfam:p450 32 464 1.9e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is involved in the conversion of cholesterol to bile acids. Its substrates include the oxysterols 25-hydroxycholesterol, 27-hydroxycholesterol and 24-hydroxycholesterol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,863,197 probably null Het
Aadacl4 G A 4: 144,623,156 V328I probably benign Het
Adcy7 A T 8: 88,326,190 H968L probably benign Het
Ahnak G A 19: 9,011,483 G3377E probably damaging Het
Ank3 A G 10: 69,982,182 T56A possibly damaging Het
Anpep A G 7: 79,840,896 S291P probably benign Het
Arap3 G A 18: 37,973,312 P1493S probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C1rb T C 6: 124,574,539 Y203H probably benign Het
Caprin1 G T 2: 103,769,517 N604K probably damaging Het
Ccdc130 A T 8: 84,258,770 V290E probably benign Het
Chrd A G 16: 20,741,277 E898G probably benign Het
Cobll1 T C 2: 65,098,450 D881G probably damaging Het
Defb33 G A 8: 20,897,578 G44R probably damaging Het
Ehhadh A T 16: 21,766,418 S238T probably benign Het
Eif5b G A 1: 38,037,207 R612Q possibly damaging Het
Eps8l1 G T 7: 4,470,854 R220L probably damaging Het
Frmd8 A G 19: 5,869,537 Y161H possibly damaging Het
Gad2 T A 2: 22,635,047 probably null Het
Gm11639 A T 11: 104,999,695 E4201V probably damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gm5460 T C 14: 34,036,935 F184L possibly damaging Het
Grip2 C A 6: 91,773,788 probably null Het
Hrh4 T C 18: 13,022,058 F218S possibly damaging Het
Ippk T C 13: 49,461,701 V520A probably benign Het
Kif15 T A 9: 122,986,171 Y189N probably benign Het
Kif9 T G 9: 110,514,419 probably null Het
L1td1 T C 4: 98,738,043 F825S probably damaging Het
Mcm6 C T 1: 128,345,948 E382K possibly damaging Het
Nalcn T C 14: 123,370,036 T674A probably benign Het
Nbeal1 G A 1: 60,235,562 probably null Het
Nip7 C A 8: 107,057,973 probably null Het
Npc1l1 A G 11: 6,218,675 F902S probably damaging Het
Olfr1298 C T 2: 111,649,167 probably benign Het
Pcdha6 T G 18: 36,968,541 I262M possibly damaging Het
Pcdhga1 T A 18: 37,833,333 *56R probably null Het
Plcb1 A G 2: 135,364,933 Y959C probably benign Het
Rnase9 T A 14: 51,038,991 I177L probably benign Het
Rtn3 T C 19: 7,457,259 N437S probably benign Het
Rufy3 T A 5: 88,647,214 probably null Het
Snx29 T C 16: 11,715,056 probably null Het
Szt2 C A 4: 118,372,681 R2751L unknown Het
Tagap A G 17: 7,933,965 T661A probably benign Het
Tcp10b T A 17: 13,063,028 I95K probably benign Het
Topbp1 T C 9: 103,324,378 F637L probably damaging Het
Zfp41 C T 15: 75,618,691 T164M probably benign Het
Zfp707 T A 15: 75,974,698 I126N probably benign Het
Zfp957 T C 14: 79,213,906 E151G probably damaging Het
Other mutations in Cyp39a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Cyp39a1 APN 17 43701543 missense probably benign 0.01
IGL01070:Cyp39a1 APN 17 43683022 missense probably benign 0.00
IGL01606:Cyp39a1 APN 17 43746618 splice site probably benign
IGL01769:Cyp39a1 APN 17 43749915 missense possibly damaging 0.53
IGL01916:Cyp39a1 APN 17 43731050 missense probably damaging 1.00
IGL02374:Cyp39a1 APN 17 43749981 utr 3 prime probably benign
IGL02402:Cyp39a1 APN 17 43691722 missense probably benign 0.07
IGL03097:Cyp39a1 UTSW 17 43683050 nonsense probably null
R0230:Cyp39a1 UTSW 17 43732012 missense probably damaging 1.00
R1244:Cyp39a1 UTSW 17 43749945 missense probably benign 0.13
R1572:Cyp39a1 UTSW 17 43680129 missense probably damaging 1.00
R1656:Cyp39a1 UTSW 17 43667619 missense possibly damaging 0.74
R4036:Cyp39a1 UTSW 17 43676940 missense probably damaging 0.97
R4308:Cyp39a1 UTSW 17 43730964 splice site probably null
R5081:Cyp39a1 UTSW 17 43746597 missense probably damaging 1.00
R5197:Cyp39a1 UTSW 17 43746538 missense possibly damaging 0.67
R5405:Cyp39a1 UTSW 17 43676940 missense probably damaging 1.00
R5566:Cyp39a1 UTSW 17 43685208 missense possibly damaging 0.92
R5578:Cyp39a1 UTSW 17 43680140 missense possibly damaging 0.91
R6045:Cyp39a1 UTSW 17 43731991 missense probably damaging 1.00
R6495:Cyp39a1 UTSW 17 43691694 missense probably benign 0.41
R7191:Cyp39a1 UTSW 17 43731019 nonsense probably null
R7431:Cyp39a1 UTSW 17 43683015 missense probably benign
R7522:Cyp39a1 UTSW 17 43667479 start gained probably benign
R7620:Cyp39a1 UTSW 17 43725653 splice site probably null
R8022:Cyp39a1 UTSW 17 43746577 missense probably damaging 1.00
R8143:Cyp39a1 UTSW 17 43725626 missense probably benign 0.39
R8483:Cyp39a1 UTSW 17 43683007 missense probably benign 0.01
R8964:Cyp39a1 UTSW 17 43691667 missense probably benign 0.02
R9730:Cyp39a1 UTSW 17 43680138 missense probably benign 0.01
Z1176:Cyp39a1 UTSW 17 43725577 missense probably benign 0.01
Z1176:Cyp39a1 UTSW 17 43731048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATGACCTAGCCAGGAAACTTAG -3'
(R):5'- AATCCTACCGGTCTGTCGTC -3'

Sequencing Primer
(F):5'- GCCAGGAAACTTAGTTATTTTCTCAC -3'
(R):5'- GCAATTCTGGGCACAGTTAC -3'
Posted On 2021-01-18