Mutagenetix > Incidental Mutation

Incidental Mutation 'R8550:Spta1'

659807

Institutional Source

Beutler Lab

Gene Symbol

Spta1

Ensembl Gene

ENSMUSG00000026532

Gene Name

spectrin alpha, erythrocytic 1

Synonyms

erythroid, Spna-1, ihj, Spna1

MMRRC Submission

068515-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.854) question?

Stock #

R8550 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

174000342-174076016 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 174014774 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 418 (D418V)

Ref Sequence

ENSEMBL: ENSMUSP00000027817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027817]

AlphaFold

P08032

Predicted Effect

probably damaging
Transcript: ENSMUST00000027817
AA Change: D418V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: D418V

Domain	Start	End	E-Value	Type
SPEC	55	153	3.62e-11	SMART
SPEC	159	259	1.84e-26	SMART
SPEC	265	365	1.56e-24	SMART
SPEC	371	471	8.35e-25	SMART
SPEC	477	577	1.19e-29	SMART
SPEC	583	682	2.43e-26	SMART
SPEC	688	788	1.3e-26	SMART
SPEC	794	894	1.66e-28	SMART
SPEC	900	1077	5.03e-19	SMART
SH3	978	1033	2.98e-15	SMART
SPEC	1083	1178	2.57e-16	SMART
SPEC	1184	1284	1.15e-27	SMART
SPEC	1290	1390	7.05e-23	SMART
SPEC	1396	1495	6.04e-22	SMART
SPEC	1501	1602	1.15e-27	SMART
SPEC	1608	1708	5.46e-29	SMART
SPEC	1714	1814	1.08e-32	SMART
SPEC	1820	1921	2.17e-23	SMART
SPEC	1927	2028	2.19e-19	SMART
SPEC	2042	2142	3.87e-11	SMART
SPEC	2156	2253	9.77e-8	SMART
low complexity region	2307	2318	N/A	INTRINSIC
efhand_Ca_insen	2346	2414	2.37e-27	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	T	A	2: 35,265,786 (GRCm39)	K295*	probably null	Het
AB124611	A	T	9: 21,451,882 (GRCm39)	D146V	probably damaging	Het
Adgrl3	A	T	5: 81,942,599 (GRCm39)	T1469S	possibly damaging	Het
Anxa7	G	A	14: 20,506,593 (GRCm39)	T449M	probably damaging	Het
Birc6	T	G	17: 74,864,949 (GRCm39)	S236R	probably benign	Het
C1qc	C	T	4: 136,617,587 (GRCm39)	V170I	possibly damaging	Het
Ccl25	A	G	8: 4,377,890 (GRCm39)	E50G	possibly damaging	Het
Clk1	A	T	1: 58,451,835 (GRCm39)	Y427N	probably damaging	Het
Cul9	C	A	17: 46,830,772 (GRCm39)	C1707F	probably damaging	Het
Cyp4f17	G	A	17: 32,746,936 (GRCm39)	V413I	probably benign	Het
Ddc	A	G	11: 11,785,743 (GRCm39)	W315R	probably damaging	Het
Degs1l	A	T	1: 180,887,324 (GRCm39)	D303V	probably damaging	Het
Eif1ad15	T	C	12: 88,290,652 (GRCm39)		probably benign	Het
Eogt	A	C	6: 97,089,033 (GRCm39)	H524Q	probably benign	Het
Eya4	G	A	10: 22,982,157 (GRCm39)	H601Y	probably damaging	Het
Hexa	G	A	9: 59,468,182 (GRCm39)	A270T	probably benign	Het
Hmcn2	T	C	2: 31,240,654 (GRCm39)		probably null	Het
Ighv5-17	A	T	12: 113,822,904 (GRCm39)	S72R	possibly damaging	Het
Itgad	A	G	7: 127,803,064 (GRCm39)	T7A	probably damaging	Het
Mapk8	A	T	14: 33,124,615 (GRCm39)	I139N	probably damaging	Het
Metap1	G	A	3: 138,172,077 (GRCm39)	A280V	possibly damaging	Het
Mrpl35	T	C	6: 71,793,259 (GRCm39)	K131E	probably damaging	Het
Neb	A	G	2: 52,188,924 (GRCm39)	V802A	probably benign	Het
Nlrp3	T	G	11: 59,440,097 (GRCm39)	V558G	probably damaging	Het
Nr3c1	A	T	18: 39,619,842 (GRCm39)	N148K	possibly damaging	Het
Or3a1c	A	C	11: 74,046,015 (GRCm39)	I12L	probably benign	Het
Padi6	T	C	4: 140,460,014 (GRCm39)	K359R	probably benign	Het
Rexo5	A	G	7: 119,400,568 (GRCm39)	T118A	probably benign	Het
Serpine1	A	G	5: 137,092,352 (GRCm39)	V385A	probably damaging	Het
Slc25a25	A	G	2: 32,306,205 (GRCm39)	I485T	probably damaging	Het
Slc26a3	A	T	12: 31,511,739 (GRCm39)	L441F	probably damaging	Het
Supt20	T	C	3: 54,623,063 (GRCm39)	V511A	possibly damaging	Het
Tfap2a	T	C	13: 40,882,225 (GRCm39)	T21A	probably damaging	Het
Tia1	A	G	6: 86,402,684 (GRCm39)	M232V	probably benign	Het
Tmem132a	T	C	19: 10,837,745 (GRCm39)	T522A	probably benign	Het
Top2a	A	T	11: 98,886,744 (GRCm39)	D1336E	probably benign	Het
Trav3-1	A	C	14: 52,818,390 (GRCm39)	R21S	probably benign	Het
Utrn	C	A	10: 12,689,329 (GRCm39)		probably benign	Het
Vmn1r119	A	T	7: 20,745,980 (GRCm39)	V134D	probably benign	Het
Zfta	T	C	19: 7,400,320 (GRCm39)	M262T	probably benign	Het

Other mutations in Spta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Spta1	APN	1	174,035,956 (GRCm39)	nonsense	probably null
IGL01095:Spta1	APN	1	174,041,051 (GRCm39)	missense	probably benign	0.02
IGL01144:Spta1	APN	1	174,014,829 (GRCm39)	missense	probably benign	0.05
IGL01455:Spta1	APN	1	174,030,877 (GRCm39)	missense	possibly damaging	0.78
IGL01541:Spta1	APN	1	174,044,725 (GRCm39)	missense	probably benign	0.03
IGL01613:Spta1	APN	1	174,035,960 (GRCm39)	missense	probably damaging	1.00
IGL01804:Spta1	APN	1	174,071,746 (GRCm39)	missense	probably benign	0.42
IGL01859:Spta1	APN	1	174,001,938 (GRCm39)	missense	probably damaging	1.00
IGL01898:Spta1	APN	1	174,041,428 (GRCm39)	missense	probably benign	0.00
IGL02106:Spta1	APN	1	174,030,860 (GRCm39)	missense	probably benign	0.02
IGL02166:Spta1	APN	1	174,017,797 (GRCm39)	missense	probably damaging	1.00
IGL02224:Spta1	APN	1	174,045,255 (GRCm39)	critical splice donor site	probably benign
IGL02318:Spta1	APN	1	174,002,029 (GRCm39)	missense	possibly damaging	0.51
IGL02392:Spta1	APN	1	174,046,380 (GRCm39)	missense	probably damaging	0.96
IGL02852:Spta1	APN	1	174,071,676 (GRCm39)	missense	probably benign	0.24
IGL02861:Spta1	APN	1	174,039,164 (GRCm39)	missense	probably damaging	1.00
IGL02982:Spta1	APN	1	174,014,854 (GRCm39)	missense	probably benign	0.00
IGL03057:Spta1	APN	1	174,008,624 (GRCm39)	missense	probably benign	0.19
IGL03215:Spta1	APN	1	174,046,309 (GRCm39)	missense	probably damaging	1.00
IGL03263:Spta1	APN	1	174,041,484 (GRCm39)	missense	probably damaging	0.99
IGL03272:Spta1	APN	1	174,041,710 (GRCm39)	missense	probably benign	0.08
bounced	UTSW	1	174,052,023 (GRCm39)	missense	probably damaging	1.00
Capillus	UTSW	1	174,045,254 (GRCm39)	critical splice donor site	probably null
Deflection	UTSW	1	174,068,653 (GRCm39)	missense	probably damaging	1.00
Goldfoil	UTSW	1	174,046,078 (GRCm39)	missense	probably damaging	1.00
hanging	UTSW	1	174,006,315 (GRCm39)	missense	probably damaging	0.99
Klimt	UTSW	1	174,029,952 (GRCm39)	missense	probably damaging	1.00
Rutherford	UTSW	1	174,034,676 (GRCm39)	missense	probably null	1.00
Thread	UTSW	1	174,025,201 (GRCm39)	nonsense	probably null
H8786:Spta1	UTSW	1	174,007,405 (GRCm39)	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174,032,839 (GRCm39)	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174,032,839 (GRCm39)	missense	probably damaging	0.98
R0010:Spta1	UTSW	1	174,045,509 (GRCm39)	missense	probably benign	0.03
R0010:Spta1	UTSW	1	174,045,509 (GRCm39)	missense	probably benign	0.03
R0078:Spta1	UTSW	1	174,034,598 (GRCm39)	splice site	probably benign
R0172:Spta1	UTSW	1	174,058,352 (GRCm39)	missense	probably damaging	1.00
R0206:Spta1	UTSW	1	174,020,526 (GRCm39)	missense	probably damaging	1.00
R0208:Spta1	UTSW	1	174,020,526 (GRCm39)	missense	probably damaging	1.00
R0276:Spta1	UTSW	1	174,045,460 (GRCm39)	missense	probably damaging	1.00
R0288:Spta1	UTSW	1	174,070,745 (GRCm39)	missense	probably damaging	0.99
R0323:Spta1	UTSW	1	174,046,017 (GRCm39)	missense	probably damaging	1.00
R0454:Spta1	UTSW	1	174,041,508 (GRCm39)	missense	probably damaging	1.00
R0508:Spta1	UTSW	1	174,052,023 (GRCm39)	missense	probably damaging	1.00
R0698:Spta1	UTSW	1	174,008,670 (GRCm39)	missense	probably damaging	1.00
R0751:Spta1	UTSW	1	174,012,256 (GRCm39)	missense	probably damaging	1.00
R0925:Spta1	UTSW	1	174,001,992 (GRCm39)	missense	possibly damaging	0.85
R0941:Spta1	UTSW	1	174,072,771 (GRCm39)	unclassified	probably benign
R1131:Spta1	UTSW	1	174,013,213 (GRCm39)	missense	probably damaging	1.00
R1171:Spta1	UTSW	1	174,039,180 (GRCm39)	nonsense	probably null
R1184:Spta1	UTSW	1	174,012,256 (GRCm39)	missense	probably damaging	1.00
R1401:Spta1	UTSW	1	174,050,250 (GRCm39)	missense	probably damaging	1.00
R1489:Spta1	UTSW	1	174,058,891 (GRCm39)	missense	probably damaging	0.97
R1532:Spta1	UTSW	1	174,074,919 (GRCm39)	missense	probably damaging	0.99
R1551:Spta1	UTSW	1	174,067,732 (GRCm39)	missense	possibly damaging	0.94
R1555:Spta1	UTSW	1	174,006,315 (GRCm39)	missense	probably damaging	0.99
R1566:Spta1	UTSW	1	174,012,272 (GRCm39)	missense	probably benign	0.00
R1586:Spta1	UTSW	1	174,041,061 (GRCm39)	missense	probably benign	0.00
R1676:Spta1	UTSW	1	174,007,405 (GRCm39)	missense	probably damaging	0.98
R1711:Spta1	UTSW	1	174,068,608 (GRCm39)	missense	probably damaging	1.00
R1795:Spta1	UTSW	1	174,073,296 (GRCm39)	missense	probably damaging	1.00
R1823:Spta1	UTSW	1	174,074,115 (GRCm39)	missense	probably benign	0.05
R1842:Spta1	UTSW	1	174,023,513 (GRCm39)	missense	probably benign	0.00
R1867:Spta1	UTSW	1	174,047,405 (GRCm39)	missense	probably benign	0.33
R1970:Spta1	UTSW	1	174,067,933 (GRCm39)	missense	possibly damaging	0.88
R2042:Spta1	UTSW	1	174,039,213 (GRCm39)	missense	probably benign	0.20
R2095:Spta1	UTSW	1	174,071,764 (GRCm39)	missense	possibly damaging	0.75
R2125:Spta1	UTSW	1	174,035,910 (GRCm39)	missense	possibly damaging	0.80
R2145:Spta1	UTSW	1	174,040,180 (GRCm39)	missense	probably benign	0.00
R2158:Spta1	UTSW	1	174,056,824 (GRCm39)	missense	probably benign	0.41
R2187:Spta1	UTSW	1	174,020,532 (GRCm39)	missense	probably damaging	1.00
R2250:Spta1	UTSW	1	174,071,680 (GRCm39)	missense	probably damaging	1.00
R2258:Spta1	UTSW	1	174,001,907 (GRCm39)	missense	possibly damaging	0.76
R2319:Spta1	UTSW	1	174,006,222 (GRCm39)	critical splice acceptor site	probably null
R3782:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R4058:Spta1	UTSW	1	174,068,703 (GRCm39)	missense	probably damaging	1.00
R4080:Spta1	UTSW	1	174,041,632 (GRCm39)	missense	probably benign	0.00
R4081:Spta1	UTSW	1	174,041,632 (GRCm39)	missense	probably benign	0.00
R4082:Spta1	UTSW	1	174,041,632 (GRCm39)	missense	probably benign	0.00
R4108:Spta1	UTSW	1	174,002,122 (GRCm39)	missense	probably benign	0.01
R4115:Spta1	UTSW	1	174,067,923 (GRCm39)	missense	probably damaging	1.00
R4303:Spta1	UTSW	1	174,007,418 (GRCm39)	missense	probably damaging	1.00
R4419:Spta1	UTSW	1	174,074,990 (GRCm39)	nonsense	probably null
R4525:Spta1	UTSW	1	174,034,676 (GRCm39)	missense	probably null	1.00
R4614:Spta1	UTSW	1	174,020,543 (GRCm39)	missense	probably damaging	1.00
R4673:Spta1	UTSW	1	174,018,628 (GRCm39)	splice site	probably null
R4782:Spta1	UTSW	1	174,058,232 (GRCm39)	missense	probably benign	0.01
R4825:Spta1	UTSW	1	174,071,608 (GRCm39)	critical splice acceptor site	probably null
R4829:Spta1	UTSW	1	174,065,493 (GRCm39)	missense	probably benign	0.01
R4873:Spta1	UTSW	1	174,003,396 (GRCm39)	missense	probably damaging	1.00
R4875:Spta1	UTSW	1	174,003,396 (GRCm39)	missense	probably damaging	1.00
R4898:Spta1	UTSW	1	174,065,400 (GRCm39)	missense	possibly damaging	0.94
R4910:Spta1	UTSW	1	174,045,429 (GRCm39)	splice site	probably null
R4911:Spta1	UTSW	1	174,013,213 (GRCm39)	missense	probably damaging	1.00
R4928:Spta1	UTSW	1	174,018,622 (GRCm39)	missense	probably benign	0.15
R4959:Spta1	UTSW	1	174,074,174 (GRCm39)	missense	probably damaging	0.97
R5009:Spta1	UTSW	1	174,067,789 (GRCm39)	missense	possibly damaging	0.62
R5149:Spta1	UTSW	1	174,075,000 (GRCm39)	missense	probably damaging	0.99
R5293:Spta1	UTSW	1	174,023,551 (GRCm39)	missense	probably damaging	0.99
R5421:Spta1	UTSW	1	174,043,095 (GRCm39)	missense	probably damaging	0.99
R5457:Spta1	UTSW	1	174,044,759 (GRCm39)	missense	probably damaging	1.00
R5590:Spta1	UTSW	1	174,003,336 (GRCm39)	missense	possibly damaging	0.73
R5606:Spta1	UTSW	1	174,047,468 (GRCm39)	missense	probably damaging	1.00
R5736:Spta1	UTSW	1	174,041,821 (GRCm39)	critical splice donor site	probably null
R5834:Spta1	UTSW	1	174,012,363 (GRCm39)	splice site	probably null
R5845:Spta1	UTSW	1	174,068,662 (GRCm39)	missense	probably damaging	0.97
R5987:Spta1	UTSW	1	174,050,894 (GRCm39)	missense	probably damaging	1.00
R6102:Spta1	UTSW	1	174,052,086 (GRCm39)	missense	probably benign	0.01
R6221:Spta1	UTSW	1	174,009,342 (GRCm39)	missense	probably damaging	1.00
R6276:Spta1	UTSW	1	174,046,078 (GRCm39)	missense	probably damaging	1.00
R6317:Spta1	UTSW	1	174,068,653 (GRCm39)	missense	probably damaging	1.00
R6329:Spta1	UTSW	1	174,041,743 (GRCm39)	missense	possibly damaging	0.60
R6352:Spta1	UTSW	1	174,039,212 (GRCm39)	missense	possibly damaging	0.94
R6374:Spta1	UTSW	1	174,041,734 (GRCm39)	missense	probably damaging	1.00
R6376:Spta1	UTSW	1	174,030,888 (GRCm39)	missense	probably benign
R6387:Spta1	UTSW	1	174,058,899 (GRCm39)	missense	probably benign	0.01
R6451:Spta1	UTSW	1	174,044,767 (GRCm39)	missense	probably damaging	0.97
R6480:Spta1	UTSW	1	174,014,714 (GRCm39)	splice site	probably null
R6533:Spta1	UTSW	1	174,071,713 (GRCm39)	missense	probably damaging	1.00
R6585:Spta1	UTSW	1	174,006,251 (GRCm39)	missense	probably damaging	1.00
R6695:Spta1	UTSW	1	174,071,608 (GRCm39)	critical splice acceptor site	probably null
R6945:Spta1	UTSW	1	174,036,891 (GRCm39)	missense	possibly damaging	0.89
R7020:Spta1	UTSW	1	174,036,918 (GRCm39)	missense	probably damaging	1.00
R7086:Spta1	UTSW	1	174,027,050 (GRCm39)	missense	probably damaging	0.98
R7087:Spta1	UTSW	1	174,002,076 (GRCm39)	missense	probably benign
R7151:Spta1	UTSW	1	174,025,317 (GRCm39)	missense	probably damaging	1.00
R7193:Spta1	UTSW	1	174,012,178 (GRCm39)	missense	probably damaging	1.00
R7199:Spta1	UTSW	1	174,050,837 (GRCm39)	missense	possibly damaging	0.61
R7219:Spta1	UTSW	1	174,050,203 (GRCm39)	missense	probably damaging	0.96
R7343:Spta1	UTSW	1	174,050,915 (GRCm39)	missense	probably damaging	0.99
R7372:Spta1	UTSW	1	174,025,201 (GRCm39)	nonsense	probably null
R7472:Spta1	UTSW	1	174,074,065 (GRCm39)	missense	probably damaging	1.00
R7516:Spta1	UTSW	1	174,025,349 (GRCm39)	missense	probably damaging	1.00
R7627:Spta1	UTSW	1	174,032,944 (GRCm39)	missense	probably damaging	1.00
R7770:Spta1	UTSW	1	174,023,547 (GRCm39)	nonsense	probably null
R7784:Spta1	UTSW	1	174,030,017 (GRCm39)	missense	probably damaging	1.00
R7804:Spta1	UTSW	1	174,023,471 (GRCm39)	missense	possibly damaging	0.50
R7854:Spta1	UTSW	1	174,046,396 (GRCm39)	critical splice donor site	probably null
R7862:Spta1	UTSW	1	174,025,351 (GRCm39)	critical splice donor site	probably null
R7958:Spta1	UTSW	1	174,001,956 (GRCm39)	missense	probably benign	0.03
R8015:Spta1	UTSW	1	174,067,737 (GRCm39)	missense	probably damaging	1.00
R8059:Spta1	UTSW	1	174,045,936 (GRCm39)	intron	probably benign
R8076:Spta1	UTSW	1	174,014,797 (GRCm39)	missense	probably benign	0.00
R8152:Spta1	UTSW	1	174,045,510 (GRCm39)	missense	probably benign	0.03
R8235:Spta1	UTSW	1	174,029,952 (GRCm39)	missense	probably damaging	1.00
R8284:Spta1	UTSW	1	174,007,387 (GRCm39)	missense	probably benign	0.00
R8298:Spta1	UTSW	1	174,074,953 (GRCm39)	missense	probably damaging	1.00
R8312:Spta1	UTSW	1	174,067,777 (GRCm39)	missense	probably damaging	1.00
R8495:Spta1	UTSW	1	174,043,051 (GRCm39)	missense	probably benign	0.00
R8675:Spta1	UTSW	1	174,058,249 (GRCm39)	missense	probably benign	0.01
R8757:Spta1	UTSW	1	174,040,940 (GRCm39)	missense	probably damaging	1.00
R8759:Spta1	UTSW	1	174,040,940 (GRCm39)	missense	probably damaging	1.00
R8848:Spta1	UTSW	1	174,025,310 (GRCm39)	missense	probably benign	0.05
R8883:Spta1	UTSW	1	174,021,145 (GRCm39)	missense	possibly damaging	0.82
R8884:Spta1	UTSW	1	174,045,254 (GRCm39)	critical splice donor site	probably null
R8896:Spta1	UTSW	1	174,045,548 (GRCm39)	missense	probably damaging	1.00
R8953:Spta1	UTSW	1	174,058,241 (GRCm39)	missense	probably benign	0.10
R9006:Spta1	UTSW	1	174,047,537 (GRCm39)	missense	probably damaging	1.00
R9013:Spta1	UTSW	1	174,050,174 (GRCm39)	missense	probably damaging	1.00
R9077:Spta1	UTSW	1	174,045,170 (GRCm39)	missense	probably damaging	1.00
R9129:Spta1	UTSW	1	174,058,911 (GRCm39)	missense	possibly damaging	0.77
R9207:Spta1	UTSW	1	174,039,139 (GRCm39)	missense	probably benign	0.01
R9229:Spta1	UTSW	1	174,067,750 (GRCm39)	missense	probably damaging	1.00
R9281:Spta1	UTSW	1	174,047,444 (GRCm39)	missense	probably damaging	1.00
R9290:Spta1	UTSW	1	174,045,204 (GRCm39)	missense	possibly damaging	0.94
R9307:Spta1	UTSW	1	174,035,978 (GRCm39)	missense	probably damaging	1.00
R9489:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R9605:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R9685:Spta1	UTSW	1	174,032,925 (GRCm39)	missense	probably damaging	1.00
RF002:Spta1	UTSW	1	174,058,926 (GRCm39)	missense	possibly damaging	0.62
RF018:Spta1	UTSW	1	174,036,885 (GRCm39)	missense	probably damaging	1.00
RF020:Spta1	UTSW	1	174,045,469 (GRCm39)	missense	probably damaging	1.00
RF020:Spta1	UTSW	1	174,041,010 (GRCm39)	missense	probably benign	0.42
T0722:Spta1	UTSW	1	174,018,632 (GRCm39)	splice site	probably benign
X0028:Spta1	UTSW	1	174,052,016 (GRCm39)	missense	probably damaging	1.00
Z1176:Spta1	UTSW	1	174,067,933 (GRCm39)	missense	probably damaging	0.99
Z1176:Spta1	UTSW	1	174,018,617 (GRCm39)	missense	probably damaging	1.00
Z1177:Spta1	UTSW	1	174,073,255 (GRCm39)	missense	probably benign	0.02
Z1177:Spta1	UTSW	1	174,017,728 (GRCm39)	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GATTCACAAAGAAAATGGTCCAGC -3'
(R):5'- AGAAAGATTGCCTCATGAGCACAAG -3'

Sequencing Primer
(F):5'- TGGTCCAGCATTAATTTTTCCAAC -3'
(R):5'- CCTCATGAGCACAAGATGGATG -3'

Posted On

2021-01-18