Mutagenetix > Incidental Mutations

Incidental Mutation 'R8550:Padi6'

659816

Institutional Source

Beutler Lab

Gene Symbol

Padi6

Ensembl Gene

ENSMUSG00000040935

Gene Name

peptidyl arginine deiminase, type VI

Synonyms

Padi5, Pad6, ePAD

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8550 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

140727355-140742643 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140732703 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 359 (K359R)

Ref Sequence

ENSEMBL: ENSMUSP00000044044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038749] [ENSMUST00000130267]

AlphaFold

Q8K3V4

Predicted Effect

probably benign
Transcript: ENSMUST00000038749
AA Change: K359R

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: K359R

Domain	Start	End	E-Value	Type
Pfam:PAD_N	1	112	5.6e-38	PFAM
Pfam:PAD_M	114	269	6e-53	PFAM
Pfam:PAD	280	679	4.7e-149	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130267

SMART Domains

Protein: ENSMUSP00000123490
Gene: ENSMUSG00000040935

Domain	Start	End	E-Value	Type
Pfam:PAD_M	39	191	1.1e-57	PFAM

Meta Mutation Damage Score

0.0670

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	T	C	19: 7,422,955	M262T	probably benign	Het
4930402F06Rik	T	A	2: 35,375,774	K295*	probably null	Het
9130409I23Rik	A	T	1: 181,059,759	D303V	probably damaging	Het
AB124611	A	T	9: 21,540,586	D146V	probably damaging	Het
Adgrl3	A	T	5: 81,794,752	T1469S	possibly damaging	Het
Anxa7	G	A	14: 20,456,525	T449M	probably damaging	Het
Birc6	T	G	17: 74,557,954	S236R	probably benign	Het
C1qc	C	T	4: 136,890,276	V170I	possibly damaging	Het
Ccl25	A	G	8: 4,327,890	E50G	possibly damaging	Het
Clk1	A	T	1: 58,412,676	Y427N	probably damaging	Het
Cul9	C	A	17: 46,519,846	C1707F	probably damaging	Het
Cyp4f17	G	A	17: 32,527,962	V413I	probably benign	Het
Ddc	A	G	11: 11,835,743	W315R	probably damaging	Het
Eogt	A	C	6: 97,112,072	H524Q	probably benign	Het
Eya4	G	A	10: 23,106,258	H601Y	probably damaging	Het
Gm5039	T	C	12: 88,323,882		probably benign	Het
Hexa	G	A	9: 59,560,899	A270T	probably benign	Het
Hmcn2	T	C	2: 31,350,642		probably null	Het
Ighv5-17	A	T	12: 113,859,284	S72R	possibly damaging	Het
Itgad	A	G	7: 128,203,892	T7A	probably damaging	Het
Mapk8	A	T	14: 33,402,658	I139N	probably damaging	Het
Metap1	G	A	3: 138,466,316	A280V	possibly damaging	Het
Mrpl35	T	C	6: 71,816,275	K131E	probably damaging	Het
Neb	A	G	2: 52,298,912	V802A	probably benign	Het
Nlrp3	T	G	11: 59,549,271	V558G	probably damaging	Het
Nr3c1	A	T	18: 39,486,789	N148K	possibly damaging	Het
Olfr402	A	C	11: 74,155,189	I12L	probably benign	Het
Rexo5	A	G	7: 119,801,345	T118A	probably benign	Het
Serpine1	A	G	5: 137,063,498	V385A	probably damaging	Het
Slc25a25	A	G	2: 32,416,193	I485T	probably damaging	Het
Slc26a3	A	T	12: 31,461,740	L441F	probably damaging	Het
Spta1	A	T	1: 174,187,208	D418V	probably damaging	Het
Supt20	T	C	3: 54,715,642	V511A	possibly damaging	Het
Tfap2a	T	C	13: 40,728,749	T21A	probably damaging	Het
Tia1	A	G	6: 86,425,702	M232V	probably benign	Het
Tmem132a	T	C	19: 10,860,381	T522A	probably benign	Het
Top2a	A	T	11: 98,995,918	D1336E	probably benign	Het
Trav3-1	A	C	14: 52,580,933	R21S	probably benign	Het
Utrn	C	A	10: 12,813,585		probably benign	Het
Vmn1r119	A	T	7: 21,012,055	V134D	probably benign	Het

Other mutations in Padi6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Padi6	APN	4	140727623	missense	possibly damaging	0.56
IGL01013:Padi6	APN	4	140729003	missense	probably damaging	0.98
IGL01068:Padi6	APN	4	140730953	missense	possibly damaging	0.70
IGL01945:Padi6	APN	4	140741924	missense	probably benign	0.24
streetwise	UTSW	4	140741558	nonsense	probably null
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0135:Padi6	UTSW	4	140737352	missense	probably benign	0.04
R0437:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R1581:Padi6	UTSW	4	140735836	missense	probably damaging	1.00
R2024:Padi6	UTSW	4	140728968	missense	possibly damaging	0.78
R3150:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3176:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3177:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3276:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3277:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R4168:Padi6	UTSW	4	140741934	missense	probably damaging	0.99
R4727:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R5063:Padi6	UTSW	4	140741880	missense	probably benign	0.01
R5382:Padi6	UTSW	4	140731210	missense	probably damaging	1.00
R5408:Padi6	UTSW	4	140727685	missense	probably damaging	1.00
R5604:Padi6	UTSW	4	140731162	missense	probably damaging	0.96
R5790:Padi6	UTSW	4	140732258	missense	probably damaging	1.00
R7084:Padi6	UTSW	4	140741558	nonsense	probably null
R7533:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R7581:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R7662:Padi6	UTSW	4	140728995	missense	probably benign	0.00
R7766:Padi6	UTSW	4	140730975	missense	probably benign	0.02
R7872:Padi6	UTSW	4	140727762	missense	probably damaging	1.00
R8333:Padi6	UTSW	4	140737376	missense	probably damaging	1.00
R8347:Padi6	UTSW	4	140735408	missense	probably benign	0.00
R8979:Padi6	UTSW	4	140739163	missense	probably benign	0.03
RF007:Padi6	UTSW	4	140729743	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCACACCACTGACTGTCG -3'
(R):5'- AAAGCTTTGAGGGCTGAGC -3'

Sequencing Primer
(F):5'- ACTGTCGGGGGACTTATACAC -3'
(R):5'- CAGCAGATGGAGAGAATTTA -3'

Posted On

2021-01-18