Incidental Mutation 'R8550:Padi6'
ID 659816
Institutional Source Beutler Lab
Gene Symbol Padi6
Ensembl Gene ENSMUSG00000040935
Gene Name peptidyl arginine deiminase, type VI
Synonyms Padi5, Pad6, ePAD
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8550 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 140727355-140742643 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140732703 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 359 (K359R)
Ref Sequence ENSEMBL: ENSMUSP00000044044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038749] [ENSMUST00000130267]
AlphaFold Q8K3V4
Predicted Effect probably benign
Transcript: ENSMUST00000038749
AA Change: K359R

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: K359R

DomainStartEndE-ValueType
Pfam:PAD_N 1 112 5.6e-38 PFAM
Pfam:PAD_M 114 269 6e-53 PFAM
Pfam:PAD 280 679 4.7e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130267
SMART Domains Protein: ENSMUSP00000123490
Gene: ENSMUSG00000040935

DomainStartEndE-ValueType
Pfam:PAD_M 39 191 1.1e-57 PFAM
Meta Mutation Damage Score 0.0670 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,955 M262T probably benign Het
4930402F06Rik T A 2: 35,375,774 K295* probably null Het
9130409I23Rik A T 1: 181,059,759 D303V probably damaging Het
AB124611 A T 9: 21,540,586 D146V probably damaging Het
Adgrl3 A T 5: 81,794,752 T1469S possibly damaging Het
Anxa7 G A 14: 20,456,525 T449M probably damaging Het
Birc6 T G 17: 74,557,954 S236R probably benign Het
C1qc C T 4: 136,890,276 V170I possibly damaging Het
Ccl25 A G 8: 4,327,890 E50G possibly damaging Het
Clk1 A T 1: 58,412,676 Y427N probably damaging Het
Cul9 C A 17: 46,519,846 C1707F probably damaging Het
Cyp4f17 G A 17: 32,527,962 V413I probably benign Het
Ddc A G 11: 11,835,743 W315R probably damaging Het
Eogt A C 6: 97,112,072 H524Q probably benign Het
Eya4 G A 10: 23,106,258 H601Y probably damaging Het
Gm5039 T C 12: 88,323,882 probably benign Het
Hexa G A 9: 59,560,899 A270T probably benign Het
Hmcn2 T C 2: 31,350,642 probably null Het
Ighv5-17 A T 12: 113,859,284 S72R possibly damaging Het
Itgad A G 7: 128,203,892 T7A probably damaging Het
Mapk8 A T 14: 33,402,658 I139N probably damaging Het
Metap1 G A 3: 138,466,316 A280V possibly damaging Het
Mrpl35 T C 6: 71,816,275 K131E probably damaging Het
Neb A G 2: 52,298,912 V802A probably benign Het
Nlrp3 T G 11: 59,549,271 V558G probably damaging Het
Nr3c1 A T 18: 39,486,789 N148K possibly damaging Het
Olfr402 A C 11: 74,155,189 I12L probably benign Het
Rexo5 A G 7: 119,801,345 T118A probably benign Het
Serpine1 A G 5: 137,063,498 V385A probably damaging Het
Slc25a25 A G 2: 32,416,193 I485T probably damaging Het
Slc26a3 A T 12: 31,461,740 L441F probably damaging Het
Spta1 A T 1: 174,187,208 D418V probably damaging Het
Supt20 T C 3: 54,715,642 V511A possibly damaging Het
Tfap2a T C 13: 40,728,749 T21A probably damaging Het
Tia1 A G 6: 86,425,702 M232V probably benign Het
Tmem132a T C 19: 10,860,381 T522A probably benign Het
Top2a A T 11: 98,995,918 D1336E probably benign Het
Trav3-1 A C 14: 52,580,933 R21S probably benign Het
Utrn C A 10: 12,813,585 probably benign Het
Vmn1r119 A T 7: 21,012,055 V134D probably benign Het
Other mutations in Padi6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Padi6 APN 4 140727623 missense possibly damaging 0.56
IGL01013:Padi6 APN 4 140729003 missense probably damaging 0.98
IGL01068:Padi6 APN 4 140730953 missense possibly damaging 0.70
IGL01945:Padi6 APN 4 140741924 missense probably benign 0.24
streetwise UTSW 4 140741558 nonsense probably null
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0135:Padi6 UTSW 4 140737352 missense probably benign 0.04
R0437:Padi6 UTSW 4 140728929 missense probably benign 0.01
R1581:Padi6 UTSW 4 140735836 missense probably damaging 1.00
R2024:Padi6 UTSW 4 140728968 missense possibly damaging 0.78
R3150:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3176:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3177:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3276:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3277:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R4168:Padi6 UTSW 4 140741934 missense probably damaging 0.99
R4727:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R5063:Padi6 UTSW 4 140741880 missense probably benign 0.01
R5382:Padi6 UTSW 4 140731210 missense probably damaging 1.00
R5408:Padi6 UTSW 4 140727685 missense probably damaging 1.00
R5604:Padi6 UTSW 4 140731162 missense probably damaging 0.96
R5790:Padi6 UTSW 4 140732258 missense probably damaging 1.00
R7084:Padi6 UTSW 4 140741558 nonsense probably null
R7533:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R7581:Padi6 UTSW 4 140728929 missense probably benign 0.01
R7662:Padi6 UTSW 4 140728995 missense probably benign 0.00
R7766:Padi6 UTSW 4 140730975 missense probably benign 0.02
R7872:Padi6 UTSW 4 140727762 missense probably damaging 1.00
R8333:Padi6 UTSW 4 140737376 missense probably damaging 1.00
R8347:Padi6 UTSW 4 140735408 missense probably benign 0.00
R8979:Padi6 UTSW 4 140739163 missense probably benign 0.03
RF007:Padi6 UTSW 4 140729743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCACACCACTGACTGTCG -3'
(R):5'- AAAGCTTTGAGGGCTGAGC -3'

Sequencing Primer
(F):5'- ACTGTCGGGGGACTTATACAC -3'
(R):5'- CAGCAGATGGAGAGAATTTA -3'
Posted On 2021-01-18