Incidental Mutation 'R8550:Ddc'
ID659830
Institutional Source Beutler Lab
Gene Symbol Ddc
Ensembl Gene ENSMUSG00000020182
Gene Namedopa decarboxylase
SynonymsAadc, aromatic L-amino acid decarboxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8550 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location11814101-11898144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11835743 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 315 (W315R)
Ref Sequence ENSEMBL: ENSMUSP00000136467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066237] [ENSMUST00000109659] [ENSMUST00000178704]
AlphaFold O88533
Predicted Effect probably damaging
Transcript: ENSMUST00000066237
AA Change: W315R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068525
Gene: ENSMUSG00000020182
AA Change: W315R

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109659
AA Change: W315R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105286
Gene: ENSMUSG00000020182
AA Change: W315R

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 4.8e-174 PFAM
Pfam:Beta_elim_lyase 82 403 4.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178704
AA Change: W315R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136467
Gene: ENSMUSG00000020182
AA Change: W315R

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. Defects in this gene are the cause of aromatic L-amino-acid decarboxylase deficiency (AADCD). AADCD deficiency is an inborn error in neurotransmitter metabolism that leads to combined serotonin and catecholamine deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit preweaning phenotype. Mice homozygous for a different knock-in allele exhibit partial prenatal lethality, decreased body size, postnatal growth retardation, hypoactivity, increased anxiety, tremors, decreased heart rate and decreased dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,955 M262T probably benign Het
4930402F06Rik T A 2: 35,375,774 K295* probably null Het
9130409I23Rik A T 1: 181,059,759 D303V probably damaging Het
AB124611 A T 9: 21,540,586 D146V probably damaging Het
Adgrl3 A T 5: 81,794,752 T1469S possibly damaging Het
Anxa7 G A 14: 20,456,525 T449M probably damaging Het
Birc6 T G 17: 74,557,954 S236R probably benign Het
C1qc C T 4: 136,890,276 V170I possibly damaging Het
Ccl25 A G 8: 4,327,890 E50G possibly damaging Het
Clk1 A T 1: 58,412,676 Y427N probably damaging Het
Cul9 C A 17: 46,519,846 C1707F probably damaging Het
Cyp4f17 G A 17: 32,527,962 V413I probably benign Het
Eogt A C 6: 97,112,072 H524Q probably benign Het
Eya4 G A 10: 23,106,258 H601Y probably damaging Het
Gm5039 T C 12: 88,323,882 probably benign Het
Hexa G A 9: 59,560,899 A270T probably benign Het
Hmcn2 T C 2: 31,350,642 probably null Het
Ighv5-17 A T 12: 113,859,284 S72R possibly damaging Het
Itgad A G 7: 128,203,892 T7A probably damaging Het
Mapk8 A T 14: 33,402,658 I139N probably damaging Het
Metap1 G A 3: 138,466,316 A280V possibly damaging Het
Mrpl35 T C 6: 71,816,275 K131E probably damaging Het
Neb A G 2: 52,298,912 V802A probably benign Het
Nlrp3 T G 11: 59,549,271 V558G probably damaging Het
Nr3c1 A T 18: 39,486,789 N148K possibly damaging Het
Olfr402 A C 11: 74,155,189 I12L probably benign Het
Padi6 T C 4: 140,732,703 K359R probably benign Het
Rexo5 A G 7: 119,801,345 T118A probably benign Het
Serpine1 A G 5: 137,063,498 V385A probably damaging Het
Slc25a25 A G 2: 32,416,193 I485T probably damaging Het
Slc26a3 A T 12: 31,461,740 L441F probably damaging Het
Spta1 A T 1: 174,187,208 D418V probably damaging Het
Supt20 T C 3: 54,715,642 V511A possibly damaging Het
Tfap2a T C 13: 40,728,749 T21A probably damaging Het
Tia1 A G 6: 86,425,702 M232V probably benign Het
Tmem132a T C 19: 10,860,381 T522A probably benign Het
Top2a A T 11: 98,995,918 D1336E probably benign Het
Trav3-1 A C 14: 52,580,933 R21S probably benign Het
Utrn C A 10: 12,813,585 probably benign Het
Vmn1r119 A T 7: 21,012,055 V134D probably benign Het
Other mutations in Ddc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Ddc APN 11 11839462 missense probably damaging 1.00
IGL01336:Ddc APN 11 11846630 splice site probably null
IGL02257:Ddc APN 11 11873171 nonsense probably null
IGL02327:Ddc APN 11 11863739 missense probably damaging 0.98
IGL02516:Ddc APN 11 11829125 missense probably damaging 1.00
IGL02616:Ddc APN 11 11880645 utr 5 prime probably benign
IGL02888:Ddc APN 11 11822297 splice site probably benign
IGL03267:Ddc APN 11 11876303 missense probably damaging 1.00
R0454:Ddc UTSW 11 11880587 missense possibly damaging 0.88
R1061:Ddc UTSW 11 11829132 missense probably benign 0.00
R1173:Ddc UTSW 11 11846634 critical splice donor site probably null
R1382:Ddc UTSW 11 11824856 missense possibly damaging 0.52
R1549:Ddc UTSW 11 11846656 splice site probably null
R1583:Ddc UTSW 11 11829131 missense probably benign 0.17
R1929:Ddc UTSW 11 11835764 missense probably damaging 1.00
R1970:Ddc UTSW 11 11815292 missense possibly damaging 0.87
R2034:Ddc UTSW 11 11880456 missense probably benign 0.40
R2270:Ddc UTSW 11 11835764 missense probably damaging 1.00
R2272:Ddc UTSW 11 11835764 missense probably damaging 1.00
R4449:Ddc UTSW 11 11835802 missense probably damaging 1.00
R4508:Ddc UTSW 11 11819393 critical splice acceptor site probably null
R4799:Ddc UTSW 11 11846632 splice site probably null
R5307:Ddc UTSW 11 11876321 missense probably damaging 1.00
R6654:Ddc UTSW 11 11880452 missense probably damaging 1.00
R6817:Ddc UTSW 11 11824854 missense probably damaging 1.00
R6918:Ddc UTSW 11 11819307 missense probably damaging 1.00
R7001:Ddc UTSW 11 11824870 critical splice acceptor site probably null
R7784:Ddc UTSW 11 11839396 critical splice donor site probably null
R8435:Ddc UTSW 11 11864902 missense probably damaging 0.97
Z1177:Ddc UTSW 11 11880552 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGAGCAAGAATTCCAGCAG -3'
(R):5'- TCTCACGTGAGGAATCTTGCG -3'

Sequencing Primer
(F):5'- TTCCAGCAGCACTCTGAAATGG -3'
(R):5'- TGATCTTAGAGCCTGGGACCTAAAAC -3'
Posted On2021-01-18