Incidental Mutation 'R8551:Trim69'
ID659853
Institutional Source Beutler Lab
Gene Symbol Trim69
Ensembl Gene ENSMUSG00000033368
Gene Nametripartite motif-containing 69
Synonyms4921519C19Rik, Rnf36, Trif
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8551 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location122160700-122179027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122173329 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 253 (D253G)
Ref Sequence ENSEMBL: ENSMUSP00000047627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028665] [ENSMUST00000036089]
Predicted Effect probably benign
Transcript: ENSMUST00000028665
SMART Domains Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:PAT1 247 490 6.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036089
AA Change: D253G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047627
Gene: ENSMUSG00000033368
AA Change: D253G

DomainStartEndE-ValueType
RING 42 82 8.48e-8 SMART
low complexity region 95 111 N/A INTRINSIC
PDB:4NQJ|C 144 322 2e-86 PDB
PRY 323 375 9.37e-19 SMART
SPRY 376 500 4.97e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 G A 7: 82,540,470 R634H probably benign Het
Birc6 T G 17: 74,557,954 S236R probably benign Het
Dnah12 T A 14: 26,774,270 I1493K probably damaging Het
Dnah7b T C 1: 46,116,200 S303P possibly damaging Het
Eri2 A T 7: 119,787,839 probably null Het
Erlec1 C A 11: 30,931,829 C467F probably damaging Het
Exph5 A G 9: 53,374,051 T811A possibly damaging Het
Galr1 T A 18: 82,406,066 I29F probably benign Het
Gata3 C A 2: 9,863,183 C320F probably damaging Het
Ggnbp2 A T 11: 84,841,525 Y247* probably null Het
Gnao1 A G 8: 93,956,107 Q307R probably damaging Het
Hbp1 T C 12: 31,930,710 T465A probably damaging Het
Liph C G 16: 21,981,408 G152R probably damaging Het
Lrguk T C 6: 34,116,511 S656P probably damaging Het
Lyrm4 T A 13: 35,979,861 N85I probably benign Het
Lyst T A 13: 13,634,060 I105N possibly damaging Het
Maml3 T C 3: 51,857,067 T159A probably benign Het
Man1c1 A T 4: 134,703,015 L152* probably null Het
Map3k20 T G 2: 72,402,360 probably benign Het
Mthfsl G T 9: 88,688,890 R102S possibly damaging Het
Myo3a T A 2: 22,332,466 S391R probably benign Het
Naa50 A G 16: 44,159,633 D128G probably benign Het
Nlrp14 C T 7: 107,183,152 R519C possibly damaging Het
Olfr1475 A G 19: 13,479,745 I151T possibly damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Oxtr T C 6: 112,488,978 K274E probably damaging Het
Park2 A G 17: 11,067,216 K32R probably damaging Het
Relt T C 7: 100,863,202 probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Ryr2 T A 13: 11,560,593 I4840F possibly damaging Het
Sccpdh T A 1: 179,681,448 Y27N probably damaging Het
Slc7a5 A G 8: 121,886,311 S343P probably damaging Het
Snrnp200 A G 2: 127,227,051 D950G probably benign Het
Stk38 A G 17: 28,988,225 Y115H probably damaging Het
Tas2r116 T C 6: 132,856,030 V198A probably benign Het
Tfap2d A G 1: 19,104,800 D159G probably benign Het
Trpv4 A T 5: 114,630,839 F359I possibly damaging Het
Twist1 C T 12: 33,958,104 R43W unknown Het
Usp19 A T 9: 108,499,297 E1026V possibly damaging Het
Virma A G 4: 11,513,397 Y417C probably damaging Het
Zfp735 A G 11: 73,712,296 I689V probably benign Het
Other mutations in Trim69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Trim69 APN 2 122167714 missense probably benign 0.00
IGL01321:Trim69 APN 2 122173284 missense possibly damaging 0.84
IGL01478:Trim69 APN 2 122178443 missense probably damaging 0.98
IGL01907:Trim69 APN 2 122167661 missense probably benign 0.00
IGL01925:Trim69 APN 2 122167916 missense probably damaging 1.00
IGL03065:Trim69 APN 2 122178634 missense probably damaging 0.98
IGL03121:Trim69 APN 2 122167647 missense probably benign 0.22
IGL03206:Trim69 APN 2 122173155 missense probably benign 0.00
R0019:Trim69 UTSW 2 122174477 splice site probably null
R0019:Trim69 UTSW 2 122174477 splice site probably null
R1956:Trim69 UTSW 2 122174475 critical splice donor site probably null
R1960:Trim69 UTSW 2 122167684 missense probably benign 0.00
R2212:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3412:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3414:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3900:Trim69 UTSW 2 122178841 missense probably benign 0.03
R4470:Trim69 UTSW 2 122178599 missense probably damaging 1.00
R4950:Trim69 UTSW 2 122178746 missense probably damaging 1.00
R5045:Trim69 UTSW 2 122174246 missense probably benign 0.08
R5237:Trim69 UTSW 2 122173340 missense probably benign
R5931:Trim69 UTSW 2 122178594 missense probably damaging 0.98
R6483:Trim69 UTSW 2 122167600 nonsense probably null
R6872:Trim69 UTSW 2 122167910 missense probably damaging 1.00
R7372:Trim69 UTSW 2 122178583 missense possibly damaging 0.94
R7451:Trim69 UTSW 2 122168027 missense probably benign 0.19
R7591:Trim69 UTSW 2 122167973 missense probably benign 0.17
R8353:Trim69 UTSW 2 122168009 missense possibly damaging 0.73
Z1176:Trim69 UTSW 2 122167554 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTTTCCAGGACAACAAGATAC -3'
(R):5'- TTTCTCCCCAAGGACCTACAAG -3'

Sequencing Primer
(F):5'- GTTTCCAGGACAACAAGATACAACTG -3'
(R):5'- TACAAGCGCTCCAGTTAGTCG -3'
Posted On2021-01-18