Incidental Mutation 'R8551:Lrguk'
ID 659859
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R8551 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34029448-34134034 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34116511 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 656 (S656P)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189]
AlphaFold Q9D5S7
Predicted Effect probably damaging
Transcript: ENSMUST00000070189
AA Change: S656P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: S656P

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 G A 7: 82,540,470 R634H probably benign Het
Birc6 T G 17: 74,557,954 S236R probably benign Het
Dnah12 T A 14: 26,774,270 I1493K probably damaging Het
Dnah7b T C 1: 46,116,200 S303P possibly damaging Het
Eri2 A T 7: 119,787,839 probably null Het
Erlec1 C A 11: 30,931,829 C467F probably damaging Het
Exph5 A G 9: 53,374,051 T811A possibly damaging Het
Galr1 T A 18: 82,406,066 I29F probably benign Het
Gata3 C A 2: 9,863,183 C320F probably damaging Het
Ggnbp2 A T 11: 84,841,525 Y247* probably null Het
Gnao1 A G 8: 93,956,107 Q307R probably damaging Het
Hbp1 T C 12: 31,930,710 T465A probably damaging Het
Liph C G 16: 21,981,408 G152R probably damaging Het
Lyrm4 T A 13: 35,979,861 N85I probably benign Het
Lyst T A 13: 13,634,060 I105N possibly damaging Het
Maml3 T C 3: 51,857,067 T159A probably benign Het
Man1c1 A T 4: 134,703,015 L152* probably null Het
Map3k20 T G 2: 72,402,360 probably benign Het
Mthfsl G T 9: 88,688,890 R102S possibly damaging Het
Myo3a T A 2: 22,332,466 S391R probably benign Het
Naa50 A G 16: 44,159,633 D128G probably benign Het
Nlrp14 C T 7: 107,183,152 R519C possibly damaging Het
Olfr1475 A G 19: 13,479,745 I151T possibly damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Oxtr T C 6: 112,488,978 K274E probably damaging Het
Park2 A G 17: 11,067,216 K32R probably damaging Het
Relt T C 7: 100,863,202 probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Ryr2 T A 13: 11,560,593 I4840F possibly damaging Het
Sccpdh T A 1: 179,681,448 Y27N probably damaging Het
Slc7a5 A G 8: 121,886,311 S343P probably damaging Het
Snrnp200 A G 2: 127,227,051 D950G probably benign Het
Stk38 A G 17: 28,988,225 Y115H probably damaging Het
Tas2r116 T C 6: 132,856,030 V198A probably benign Het
Tfap2d A G 1: 19,104,800 D159G probably benign Het
Trim69 A G 2: 122,173,329 D253G probably benign Het
Trpv4 A T 5: 114,630,839 F359I possibly damaging Het
Twist1 C T 12: 33,958,104 R43W unknown Het
Usp19 A T 9: 108,499,297 E1026V possibly damaging Het
Virma A G 4: 11,513,397 Y417C probably damaging Het
Zfp735 A G 11: 73,712,296 I689V probably benign Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34043429 missense probably damaging 1.00
IGL00566:Lrguk APN 6 34056174 missense probably damaging 1.00
IGL01720:Lrguk APN 6 34043477 missense probably damaging 1.00
IGL02325:Lrguk APN 6 34129179 missense probably benign 0.31
IGL02484:Lrguk APN 6 34092791 missense probably damaging 1.00
IGL02493:Lrguk APN 6 34129192 missense probably benign 0.03
IGL02636:Lrguk APN 6 34090188 missense probably damaging 1.00
IGL03278:Lrguk APN 6 34116446 missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34043496 missense probably damaging 0.99
R1069:Lrguk UTSW 6 34048883 missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34062360 missense probably benign 0.01
R1568:Lrguk UTSW 6 34086438 missense probably damaging 1.00
R1604:Lrguk UTSW 6 34072370 missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34133387 missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34071068 missense probably damaging 1.00
R2107:Lrguk UTSW 6 34062361 missense probably benign 0.15
R2125:Lrguk UTSW 6 34092902 missense probably benign 0.05
R2136:Lrguk UTSW 6 34043519 missense probably benign 0.00
R2997:Lrguk UTSW 6 34073762 missense probably damaging 0.98
R3847:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R3849:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R4626:Lrguk UTSW 6 34129223 missense probably benign 0.00
R4718:Lrguk UTSW 6 34029496 missense probably benign 0.02
R4778:Lrguk UTSW 6 34056080 missense probably damaging 1.00
R4841:Lrguk UTSW 6 34092867 missense probably damaging 0.98
R5324:Lrguk UTSW 6 34073797 missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34071061 missense probably damaging 1.00
R5741:Lrguk UTSW 6 34048867 missense probably damaging 0.99
R5939:Lrguk UTSW 6 34078753 missense probably damaging 1.00
R5997:Lrguk UTSW 6 34129143 missense probably damaging 0.99
R6786:Lrguk UTSW 6 34095587 missense probably benign 0.11
R6802:Lrguk UTSW 6 34062457 missense probably damaging 1.00
R7081:Lrguk UTSW 6 34102139 missense probably benign 0.01
R7303:Lrguk UTSW 6 34029476 missense probably benign 0.00
R7316:Lrguk UTSW 6 34103256 missense unknown
R7473:Lrguk UTSW 6 34029695 missense probably benign 0.01
R7543:Lrguk UTSW 6 34048935 nonsense probably null
R7613:Lrguk UTSW 6 34101748 missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34095539 missense probably damaging 1.00
R7900:Lrguk UTSW 6 34129194 missense probably benign 0.01
R8012:Lrguk UTSW 6 34056103 missense probably benign 0.00
R8251:Lrguk UTSW 6 34116439 missense probably benign 0.00
R8324:Lrguk UTSW 6 34102571 missense probably benign 0.03
R8828:Lrguk UTSW 6 34103637 missense unknown
R8879:Lrguk UTSW 6 34029683 missense probably benign 0.00
X0057:Lrguk UTSW 6 34078747 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CATTGCTGTCATGTCACATCAAG -3'
(R):5'- CGTTTGGGAAAACACAATAATCTCC -3'

Sequencing Primer
(F):5'- CTGTCATGTCACATCAAGAAATTTAC -3'
(R):5'- TGGGAAAACACAATAATCTCCGAAAC -3'
Posted On 2021-01-18