Incidental Mutation 'R8551:Lrguk'
ID 659859
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 068516-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R8551 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34006379-34110969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34093446 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 656 (S656P)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189]
AlphaFold Q9D5S7
Predicted Effect probably damaging
Transcript: ENSMUST00000070189
AA Change: S656P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: S656P

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 G A 7: 82,189,678 (GRCm39) R634H probably benign Het
Birc6 T G 17: 74,864,949 (GRCm39) S236R probably benign Het
Dnah12 T A 14: 26,496,227 (GRCm39) I1493K probably damaging Het
Dnah7b T C 1: 46,155,360 (GRCm39) S303P possibly damaging Het
Eri2 A T 7: 119,387,062 (GRCm39) probably null Het
Erlec1 C A 11: 30,881,829 (GRCm39) C467F probably damaging Het
Exph5 A G 9: 53,285,351 (GRCm39) T811A possibly damaging Het
Galr1 T A 18: 82,424,191 (GRCm39) I29F probably benign Het
Gata3 C A 2: 9,867,994 (GRCm39) C320F probably damaging Het
Ggnbp2 A T 11: 84,732,351 (GRCm39) Y247* probably null Het
Gnao1 A G 8: 94,682,735 (GRCm39) Q307R probably damaging Het
Hbp1 T C 12: 31,980,709 (GRCm39) T465A probably damaging Het
Liph C G 16: 21,800,158 (GRCm39) G152R probably damaging Het
Lyrm4 T A 13: 36,163,844 (GRCm39) N85I probably benign Het
Lyst T A 13: 13,808,645 (GRCm39) I105N possibly damaging Het
Maml3 T C 3: 51,764,488 (GRCm39) T159A probably benign Het
Man1c1 A T 4: 134,430,326 (GRCm39) L152* probably null Het
Map3k20 T G 2: 72,232,704 (GRCm39) probably benign Het
Mthfsl G T 9: 88,570,943 (GRCm39) R102S possibly damaging Het
Myo3a T A 2: 22,337,277 (GRCm39) S391R probably benign Het
Naa50 A G 16: 43,979,996 (GRCm39) D128G probably benign Het
Nlrp14 C T 7: 106,782,359 (GRCm39) R519C possibly damaging Het
Or5b119 A G 19: 13,457,109 (GRCm39) I151T possibly damaging Het
Or6d14 G T 6: 116,534,289 (GRCm39) R301L probably damaging Het
Oxtr T C 6: 112,465,939 (GRCm39) K274E probably damaging Het
Prkn A G 17: 11,286,103 (GRCm39) K32R probably damaging Het
Relt T C 7: 100,512,409 (GRCm39) probably benign Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Ryr2 T A 13: 11,575,479 (GRCm39) I4840F possibly damaging Het
Sccpdh T A 1: 179,509,013 (GRCm39) Y27N probably damaging Het
Slc7a5 A G 8: 122,613,050 (GRCm39) S343P probably damaging Het
Snrnp200 A G 2: 127,068,971 (GRCm39) D950G probably benign Het
Stk38 A G 17: 29,207,199 (GRCm39) Y115H probably damaging Het
Tas2r116 T C 6: 132,832,993 (GRCm39) V198A probably benign Het
Tfap2d A G 1: 19,175,024 (GRCm39) D159G probably benign Het
Trim69 A G 2: 122,003,810 (GRCm39) D253G probably benign Het
Trpv4 A T 5: 114,768,900 (GRCm39) F359I possibly damaging Het
Twist1 C T 12: 34,008,103 (GRCm39) R43W unknown Het
Usp19 A T 9: 108,376,496 (GRCm39) E1026V possibly damaging Het
Virma A G 4: 11,513,397 (GRCm39) Y417C probably damaging Het
Zfp735 A G 11: 73,603,122 (GRCm39) I689V probably benign Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34,020,364 (GRCm39) missense probably damaging 1.00
IGL00566:Lrguk APN 6 34,033,109 (GRCm39) missense probably damaging 1.00
IGL01720:Lrguk APN 6 34,020,412 (GRCm39) missense probably damaging 1.00
IGL02325:Lrguk APN 6 34,106,114 (GRCm39) missense probably benign 0.31
IGL02484:Lrguk APN 6 34,069,726 (GRCm39) missense probably damaging 1.00
IGL02493:Lrguk APN 6 34,106,127 (GRCm39) missense probably benign 0.03
IGL02636:Lrguk APN 6 34,067,123 (GRCm39) missense probably damaging 1.00
IGL03278:Lrguk APN 6 34,093,381 (GRCm39) missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34,020,431 (GRCm39) missense probably damaging 0.99
R1069:Lrguk UTSW 6 34,025,818 (GRCm39) missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34,039,295 (GRCm39) missense probably benign 0.01
R1568:Lrguk UTSW 6 34,063,373 (GRCm39) missense probably damaging 1.00
R1604:Lrguk UTSW 6 34,049,305 (GRCm39) missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34,110,322 (GRCm39) missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34,048,003 (GRCm39) missense probably damaging 1.00
R2107:Lrguk UTSW 6 34,039,296 (GRCm39) missense probably benign 0.15
R2125:Lrguk UTSW 6 34,069,837 (GRCm39) missense probably benign 0.05
R2136:Lrguk UTSW 6 34,020,454 (GRCm39) missense probably benign 0.00
R2997:Lrguk UTSW 6 34,050,697 (GRCm39) missense probably damaging 0.98
R3847:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R3849:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R4626:Lrguk UTSW 6 34,106,158 (GRCm39) missense probably benign 0.00
R4718:Lrguk UTSW 6 34,006,431 (GRCm39) missense probably benign 0.02
R4778:Lrguk UTSW 6 34,033,015 (GRCm39) missense probably damaging 1.00
R4841:Lrguk UTSW 6 34,069,802 (GRCm39) missense probably damaging 0.98
R5324:Lrguk UTSW 6 34,050,732 (GRCm39) missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34,047,996 (GRCm39) missense probably damaging 1.00
R5741:Lrguk UTSW 6 34,025,802 (GRCm39) missense probably damaging 0.99
R5939:Lrguk UTSW 6 34,055,688 (GRCm39) missense probably damaging 1.00
R5997:Lrguk UTSW 6 34,106,078 (GRCm39) missense probably damaging 0.99
R6786:Lrguk UTSW 6 34,072,522 (GRCm39) missense probably benign 0.11
R6802:Lrguk UTSW 6 34,039,392 (GRCm39) missense probably damaging 1.00
R7081:Lrguk UTSW 6 34,079,074 (GRCm39) missense probably benign 0.01
R7303:Lrguk UTSW 6 34,006,411 (GRCm39) missense probably benign 0.00
R7316:Lrguk UTSW 6 34,080,191 (GRCm39) missense unknown
R7473:Lrguk UTSW 6 34,006,630 (GRCm39) missense probably benign 0.01
R7543:Lrguk UTSW 6 34,025,870 (GRCm39) nonsense probably null
R7613:Lrguk UTSW 6 34,078,683 (GRCm39) missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34,072,474 (GRCm39) missense probably damaging 1.00
R7900:Lrguk UTSW 6 34,106,129 (GRCm39) missense probably benign 0.01
R8012:Lrguk UTSW 6 34,033,038 (GRCm39) missense probably benign 0.00
R8251:Lrguk UTSW 6 34,093,374 (GRCm39) missense probably benign 0.00
R8324:Lrguk UTSW 6 34,079,506 (GRCm39) missense probably benign 0.03
R8828:Lrguk UTSW 6 34,080,572 (GRCm39) missense unknown
R8879:Lrguk UTSW 6 34,006,618 (GRCm39) missense probably benign 0.00
X0057:Lrguk UTSW 6 34,055,682 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CATTGCTGTCATGTCACATCAAG -3'
(R):5'- CGTTTGGGAAAACACAATAATCTCC -3'

Sequencing Primer
(F):5'- CTGTCATGTCACATCAAGAAATTTAC -3'
(R):5'- TGGGAAAACACAATAATCTCCGAAAC -3'
Posted On 2021-01-18