Incidental Mutation 'R8552:Adprhl2'
ID 659896
Institutional Source Beutler Lab
Gene Symbol Adprhl2
Ensembl Gene ENSMUSG00000042558
Gene Name ADP-ribosylhydrolase like 2
Synonyms Arh3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8552 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 126316047-126321703 bp(-) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) A to G at 126316575 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Glutamine at position 371 (*371Q)
Ref Sequence ENSEMBL: ENSMUSP00000099677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070132] [ENSMUST00000102617]
AlphaFold Q8CG72
PDB Structure Crystal Structure of mouse ADP-ribosylhydrolase 3 (mARH3) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000070132
SMART Domains Protein: ENSMUSP00000070270
Gene: ENSMUSG00000056174

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 25 33 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
low complexity region 72 105 N/A INTRINSIC
Pfam:Collagen 116 168 1.2e-9 PFAM
low complexity region 207 237 N/A INTRINSIC
internal_repeat_1 240 259 1.3e-7 PROSPERO
low complexity region 260 327 N/A INTRINSIC
low complexity region 342 387 N/A INTRINSIC
internal_repeat_1 388 407 1.3e-7 PROSPERO
low complexity region 408 429 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 471 530 N/A INTRINSIC
low complexity region 545 557 N/A INTRINSIC
C1Q 564 699 2.44e-78 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102617
AA Change: *371Q
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558
AA Change: *371Q

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADP-ribosylglycohydrolase family. The encoded enzyme catalyzes the removal of ADP-ribose from ADP-ribosylated proteins. This enzyme localizes to the mitochondria, in addition to the nucleus and cytoplasm.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 A G 6: 58,669,225 H242R possibly damaging Het
Adam1b G T 5: 121,501,441 R514S probably benign Het
Arid4a T C 12: 71,060,075 L307P probably benign Het
Armc12 C T 17: 28,538,701 A269V probably benign Het
Asb1 T A 1: 91,552,356 V259E probably damaging Het
Atm T C 9: 53,524,497 Y171C probably damaging Het
Atp8a2 A T 14: 59,773,982 F959L probably benign Het
B4galt3 G T 1: 171,274,347 E34D possibly damaging Het
Cacna1i A G 15: 80,320,397 N90S possibly damaging Het
Cdc42ep2 T A 19: 5,918,032 *215L probably null Het
Cep162 C T 9: 87,244,308 E184K probably benign Het
Cnga3 C T 1: 37,244,979 P121L probably benign Het
Cpt1b G A 15: 89,422,321 R285C probably damaging Het
Defb18 T C 1: 18,236,567 Y55C probably damaging Het
Depdc1b C T 13: 108,357,425 P116S probably damaging Het
Dhx16 C T 17: 35,881,291 A74V possibly damaging Het
Dnajc21 A T 15: 10,463,919 Y53* probably null Het
Dse T C 10: 34,152,320 R925G possibly damaging Het
Dsp C T 13: 38,185,141 L738F probably damaging Het
Erv3 T C 2: 131,856,341 K33E possibly damaging Het
Gas2l2 T A 11: 83,422,081 T802S probably benign Het
Gdf9 T C 11: 53,433,551 L49S possibly damaging Het
Gigyf1 G T 5: 137,523,139 probably benign Het
Gm4792 T A 10: 94,295,199 I83L unknown Het
Ighv9-3 A G 12: 114,140,729 L105P probably damaging Het
Krtap5-1 C A 7: 142,296,423 W189L probably null Het
Krtap5-3 T A 7: 142,202,352 probably benign Het
Lrp1b T A 2: 41,408,981 E108D probably benign Het
Lrrc66 G A 5: 73,610,885 P238S probably benign Het
Ms4a4c C T 19: 11,414,832 Q6* probably null Het
Olfr1447 A G 19: 12,901,732 L16P probably damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pinx1 A G 14: 63,919,523 R300G probably benign Het
Pkd1 T A 17: 24,591,469 H92Q probably damaging Het
Rad54l2 T A 9: 106,693,578 Q1181L possibly damaging Het
Rbl1 A T 2: 157,196,254 V131E probably damaging Het
Rbp3 A G 14: 33,955,664 E523G probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Slc22a20 C A 19: 5,985,670 C130F probably damaging Het
Smcr8 T C 11: 60,780,153 L709S probably damaging Het
Spef2 A G 15: 9,600,679 probably benign Het
Teddm1b T A 1: 153,874,448 M1K probably null Het
Tes A G 6: 17,097,328 Y60C probably damaging Het
Tmem104 T C 11: 115,197,318 L43P probably damaging Het
Tnfaip3 T C 10: 19,004,465 E618G probably damaging Het
Tnfaip3 T C 10: 19,004,666 D551G probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Trim30b T A 7: 104,366,029 T51S probably benign Het
Trmt44 G T 5: 35,565,400 H441Q probably benign Het
Tshr C A 12: 91,537,285 D332E probably benign Het
Usp10 C T 8: 119,956,628 T746M possibly damaging Het
Vmn1r8 A T 6: 57,036,153 D63V possibly damaging Het
Vps13a A C 19: 16,754,320 L143V probably damaging Het
Wnt3a T A 11: 59,275,217 H79L probably damaging Het
Zbtb7a C T 10: 81,144,307 R112W probably damaging Het
Other mutations in Adprhl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Adprhl2 APN 4 126318481 missense probably damaging 1.00
IGL02391:Adprhl2 APN 4 126317908 splice site probably benign
IGL03189:Adprhl2 APN 4 126317294 splice site probably benign
R0139:Adprhl2 UTSW 4 126318154 missense probably damaging 1.00
R0302:Adprhl2 UTSW 4 126317392 missense probably benign 0.00
R0879:Adprhl2 UTSW 4 126316617 missense probably benign
R2008:Adprhl2 UTSW 4 126317344 missense probably benign 0.05
R3789:Adprhl2 UTSW 4 126316751 missense probably damaging 0.96
R5038:Adprhl2 UTSW 4 126317309 missense possibly damaging 0.69
R5058:Adprhl2 UTSW 4 126318445 missense probably damaging 1.00
R5724:Adprhl2 UTSW 4 126318076 missense probably damaging 1.00
R6171:Adprhl2 UTSW 4 126317317 missense probably damaging 1.00
R6326:Adprhl2 UTSW 4 126316613 missense possibly damaging 0.58
R7825:Adprhl2 UTSW 4 126321696 unclassified probably benign
R9008:Adprhl2 UTSW 4 126316839 missense probably damaging 1.00
R9142:Adprhl2 UTSW 4 126321567 missense probably damaging 1.00
Z1176:Adprhl2 UTSW 4 126321567 missense probably damaging 1.00
Z1176:Adprhl2 UTSW 4 126321661 missense unknown
Predicted Primers PCR Primer
(F):5'- TCATACAGCCCTGCAGCAAG -3'
(R):5'- AGAGGACTCTCATCTACTCCATCTC -3'

Sequencing Primer
(F):5'- GAGCTGCAGCCCCAAGAAG -3'
(R):5'- TCCATCTCACTTGGTGGGGAC -3'
Posted On 2021-01-18