Incidental Mutation 'R8552:Cep162'
ID659912
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Namecentrosomal protein 162
Synonyms4922501C03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R8552 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location87189577-87255536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87244308 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 184 (E184K)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
Predicted Effect probably benign
Transcript: ENSMUST00000093802
AA Change: E184K

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: E184K

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 A G 6: 58,669,225 H242R possibly damaging Het
Adam1b G T 5: 121,501,441 R514S probably benign Het
Adprhl2 A G 4: 126,316,575 *371Q probably null Het
Arid4a T C 12: 71,060,075 L307P probably benign Het
Armc12 C T 17: 28,538,701 A269V probably benign Het
Asb1 T A 1: 91,552,356 V259E probably damaging Het
Atm T C 9: 53,524,497 Y171C probably damaging Het
Atp8a2 A T 14: 59,773,982 F959L probably benign Het
B4galt3 G T 1: 171,274,347 E34D possibly damaging Het
Cacna1i A G 15: 80,320,397 N90S possibly damaging Het
Cdc42ep2 T A 19: 5,918,032 *215L probably null Het
Cnga3 C T 1: 37,244,979 P121L probably benign Het
Cpt1b G A 15: 89,422,321 R285C probably damaging Het
Defb18 T C 1: 18,236,567 Y55C probably damaging Het
Depdc1b C T 13: 108,357,425 P116S probably damaging Het
Dhx16 C T 17: 35,881,291 A74V possibly damaging Het
Dnajc21 A T 15: 10,463,919 Y53* probably null Het
Dse T C 10: 34,152,320 R925G possibly damaging Het
Dsp C T 13: 38,185,141 L738F probably damaging Het
Erv3 T C 2: 131,856,341 K33E possibly damaging Het
Gas2l2 T A 11: 83,422,081 T802S probably benign Het
Gdf9 T C 11: 53,433,551 L49S possibly damaging Het
Gigyf1 G T 5: 137,523,139 probably benign Het
Gm4792 T A 10: 94,295,199 I83L unknown Het
Ighv9-3 A G 12: 114,140,729 L105P probably damaging Het
Krtap5-1 C A 7: 142,296,423 W189L probably null Het
Krtap5-3 T A 7: 142,202,352 probably benign Het
Lrp1b T A 2: 41,408,981 E108D probably benign Het
Lrrc66 G A 5: 73,610,885 P238S probably benign Het
Ms4a4c C T 19: 11,414,832 Q6* probably null Het
Olfr1447 A G 19: 12,901,732 L16P probably damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pinx1 A G 14: 63,919,523 R300G probably benign Het
Pkd1 T A 17: 24,591,469 H92Q probably damaging Het
Rad54l2 T A 9: 106,693,578 Q1181L possibly damaging Het
Rbl1 A T 2: 157,196,254 V131E probably damaging Het
Rbp3 A G 14: 33,955,664 E523G probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Slc22a20 C A 19: 5,985,670 C130F probably damaging Het
Smcr8 T C 11: 60,780,153 L709S probably damaging Het
Spef2 A G 15: 9,600,679 probably benign Het
Teddm1b T A 1: 153,874,448 M1K probably null Het
Tes A G 6: 17,097,328 Y60C probably damaging Het
Tmem104 T C 11: 115,197,318 L43P probably damaging Het
Tnfaip3 T C 10: 19,004,465 E618G probably damaging Het
Tnfaip3 T C 10: 19,004,666 D551G probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Trim30b T A 7: 104,366,029 T51S probably benign Het
Trmt44 G T 5: 35,565,400 H441Q probably benign Het
Tshr C A 12: 91,537,285 D332E probably benign Het
Usp10 C T 8: 119,956,628 T746M possibly damaging Het
Vmn1r8 A T 6: 57,036,153 D63V possibly damaging Het
Vps13a A C 19: 16,754,320 L143V probably damaging Het
Wnt3a T A 11: 59,275,217 H79L probably damaging Het
Zbtb7a C T 10: 81,144,307 R112W probably damaging Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87227167 missense probably benign 0.24
IGL00584:Cep162 APN 9 87221090 splice site probably benign
IGL01387:Cep162 APN 9 87211811 missense probably benign 0.08
IGL01862:Cep162 APN 9 87253933 missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87227147 splice site probably benign
IGL02558:Cep162 APN 9 87225733 missense probably benign 0.04
IGL02558:Cep162 APN 9 87225726 missense probably benign
IGL02602:Cep162 APN 9 87246153 missense probably benign 0.19
IGL02636:Cep162 APN 9 87248379 missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87246744 missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87225786 missense probably benign 0.00
circus UTSW 9 87206862 missense probably damaging 1.00
moscow UTSW 9 87193697 missense probably damaging 1.00
smiley UTSW 9 87217081 nonsense probably null
PIT4378001:Cep162 UTSW 9 87217145 missense probably benign 0.01
PIT4431001:Cep162 UTSW 9 87244345 missense probably benign 0.00
PIT4434001:Cep162 UTSW 9 87193648 missense probably damaging 1.00
R0060:Cep162 UTSW 9 87237825 splice site probably benign
R0218:Cep162 UTSW 9 87211809 missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87220484 missense probably damaging 0.96
R0468:Cep162 UTSW 9 87193697 missense probably damaging 1.00
R0764:Cep162 UTSW 9 87201745 missense probably damaging 1.00
R1386:Cep162 UTSW 9 87221202 missense probably benign
R1614:Cep162 UTSW 9 87212932 missense probably damaging 1.00
R1633:Cep162 UTSW 9 87203683 missense probably benign 0.23
R1831:Cep162 UTSW 9 87206932 missense probably damaging 1.00
R1847:Cep162 UTSW 9 87204080 missense probably benign 0.06
R1941:Cep162 UTSW 9 87199995 missense probably benign 0.14
R2228:Cep162 UTSW 9 87244331 missense probably benign 0.05
R2256:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2257:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2936:Cep162 UTSW 9 87227414 missense probably benign
R3005:Cep162 UTSW 9 87232060 missense probably benign 0.00
R3508:Cep162 UTSW 9 87231977 critical splice donor site probably null
R3689:Cep162 UTSW 9 87225694 nonsense probably null
R3743:Cep162 UTSW 9 87217177 splice site probably benign
R4118:Cep162 UTSW 9 87204176 missense probably benign 0.30
R4380:Cep162 UTSW 9 87200003 missense probably damaging 0.99
R4450:Cep162 UTSW 9 87225808 missense probably damaging 1.00
R4540:Cep162 UTSW 9 87212939 missense probably damaging 1.00
R4598:Cep162 UTSW 9 87203795 missense possibly damaging 0.95
R4700:Cep162 UTSW 9 87206862 missense probably damaging 1.00
R4941:Cep162 UTSW 9 87225969 intron probably benign
R5356:Cep162 UTSW 9 87206895 missense probably damaging 1.00
R5468:Cep162 UTSW 9 87227237 missense probably benign 0.00
R5579:Cep162 UTSW 9 87203671 missense probably benign 0.26
R5859:Cep162 UTSW 9 87204092 missense probably damaging 1.00
R6114:Cep162 UTSW 9 87203710 missense probably benign
R6143:Cep162 UTSW 9 87212851 critical splice donor site probably null
R6422:Cep162 UTSW 9 87232016 missense possibly damaging 0.92
R6517:Cep162 UTSW 9 87222174 missense probably damaging 0.99
R6576:Cep162 UTSW 9 87217145 missense probably benign 0.01
R6782:Cep162 UTSW 9 87211684 missense probably benign 0.07
R6867:Cep162 UTSW 9 87217081 nonsense probably null
R7293:Cep162 UTSW 9 87203783 missense probably benign 0.01
R7355:Cep162 UTSW 9 87253955 nonsense probably null
R7391:Cep162 UTSW 9 87248494 nonsense probably null
R7426:Cep162 UTSW 9 87192766 missense probably damaging 1.00
R7593:Cep162 UTSW 9 87204197 missense probably benign 0.40
R7710:Cep162 UTSW 9 87232119 missense probably damaging 1.00
R7841:Cep162 UTSW 9 87244316 missense probably benign 0.00
R7949:Cep162 UTSW 9 87206848 missense probably benign 0.04
R8351:Cep162 UTSW 9 87192850 nonsense probably null
R8451:Cep162 UTSW 9 87192850 nonsense probably null
R8755:Cep162 UTSW 9 87232011 missense probably benign 0.02
R8762:Cep162 UTSW 9 87227261 missense probably benign 0.00
X0063:Cep162 UTSW 9 87222042 critical splice donor site probably null
Z1177:Cep162 UTSW 9 87199980 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTTAGCTGCTGAGATAATACC -3'
(R):5'- GAAGAGTTACCTGAGTCATGGG -3'

Sequencing Primer
(F):5'- CTTAGCTGCTGAGATAATACCACAGG -3'
(R):5'- AGTTACCTGAGTCATGGGATGATAC -3'
Posted On2021-01-18