Mutagenetix > Incidental Mutation

Incidental Mutation 'R8553:Anapc1'

659952

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

Apc1, tsg24, Mcpr, 2610021O03Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8553 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

128452024-128529311 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 128461833 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 1757 (P1757L)

Ref Sequence

ENSEMBL: ENSMUSP00000014499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499]

AlphaFold

P53995

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014499
AA Change: P1757L

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: P1757L

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427I04Rik	A	G	4: 123,754,327 (GRCm39)	I80M	probably benign	Het
Acsbg3	T	A	17: 57,188,021 (GRCm39)	D176E	probably benign	Het
Aga	G	A	8: 53,973,367 (GRCm39)	R255H	probably damaging	Het
Arfgef3	T	A	10: 18,479,278 (GRCm39)	I1446L	probably damaging	Het
Auts2	T	C	5: 131,468,981 (GRCm39)	T779A	probably benign	Het
Cacna1s	T	C	1: 136,019,540 (GRCm39)	S778P	possibly damaging	Het
Cep164	A	T	9: 45,718,508 (GRCm39)		probably benign	Het
Cmya5	T	C	13: 93,230,304 (GRCm39)	T1595A	probably benign	Het
Csmd3	G	T	15: 47,484,724 (GRCm39)	T3214K	possibly damaging	Het
Dpy30	A	G	17: 74,622,913 (GRCm39)	L23P	probably damaging	Het
Edrf1	A	G	7: 133,252,047 (GRCm39)	E391G	possibly damaging	Het
Egflam	A	T	15: 7,237,229 (GRCm39)	V985E	probably damaging	Het
Elmo3	T	C	8: 106,033,810 (GRCm39)	V201A	probably benign	Het
Entrep3	A	C	3: 89,094,153 (GRCm39)	D322A	possibly damaging	Het
Epb41l5	T	A	1: 119,477,671 (GRCm39)	D700V	possibly damaging	Het
Esr1	T	C	10: 4,947,847 (GRCm39)	S467P	probably damaging	Het
Eya4	G	A	10: 22,982,157 (GRCm39)	H601Y	probably damaging	Het
Fancm	A	C	12: 65,173,469 (GRCm39)	N1927T	possibly damaging	Het
Gcfc2	A	G	6: 81,912,944 (GRCm39)	T248A	probably benign	Het
Gm29106	T	A	1: 118,128,149 (GRCm39)	C614S	probably damaging	Het
Greb1	T	C	12: 16,773,328 (GRCm39)	T249A	probably benign	Het
Hectd4	T	C	5: 121,491,661 (GRCm39)	S3700P	possibly damaging	Het
Hr	T	C	14: 70,804,965 (GRCm39)	L950P	probably damaging	Het
Hsd3b3	T	A	3: 98,651,205 (GRCm39)	T82S	possibly damaging	Het
Ifit2	C	A	19: 34,550,538 (GRCm39)	A26E	probably benign	Het
Igsf9b	A	G	9: 27,244,739 (GRCm39)	D902G	probably damaging	Het
Itga4	G	A	2: 79,131,405 (GRCm39)	R591Q	probably damaging	Het
Kcnb1	A	T	2: 166,946,531 (GRCm39)	S772R	possibly damaging	Het
Klhl32	T	A	4: 24,629,343 (GRCm39)	I213L	probably benign	Het
Lcn3	A	T	2: 25,656,347 (GRCm39)		probably null	Het
Lpin2	T	A	17: 71,538,232 (GRCm39)	S293T	probably damaging	Het
Magi2	T	C	5: 20,856,198 (GRCm39)	F840S	probably benign	Het
Myt1	G	A	2: 181,439,344 (GRCm39)	E289K	possibly damaging	Het
Ndst4	A	G	3: 125,503,756 (GRCm39)	S8G	probably damaging	Het
Nlrp4f	T	C	13: 65,343,252 (GRCm39)	D109G	possibly damaging	Het
Or6d14	G	T	6: 116,534,289 (GRCm39)	R301L	probably damaging	Het
Pcdhb12	C	T	18: 37,570,687 (GRCm39)	A611V	probably damaging	Het
Pcif1	A	T	2: 164,728,417 (GRCm39)	I225F	probably damaging	Het
Peli3	A	G	19: 4,984,960 (GRCm39)	F150L	probably damaging	Het
Qng1	G	A	13: 58,532,694 (GRCm39)	T92M	probably damaging	Het
Rfx7	A	G	9: 72,519,086 (GRCm39)	T263A	probably damaging	Het
Rpn1	A	G	6: 88,072,539 (GRCm39)	Y294C	probably damaging	Het
Rusc2	T	A	4: 43,416,508 (GRCm39)	S605T	probably benign	Het
Sec23ip	A	C	7: 128,355,777 (GRCm39)	Q300P	probably damaging	Het
Sh2d3c	A	G	2: 32,635,925 (GRCm39)	T98A	probably damaging	Het
Siah3	T	A	14: 75,763,067 (GRCm39)	I106K	probably benign	Het
Spns2	C	T	11: 72,348,053 (GRCm39)	D305N	probably damaging	Het
Sult1a1	G	T	7: 126,273,333 (GRCm39)	Q177K	probably benign	Het
Tas2r109	A	G	6: 132,957,171 (GRCm39)	I253T	probably benign	Het
Tcof1	T	C	18: 60,964,643 (GRCm39)	D661G	possibly damaging	Het
Tdrd1	A	G	19: 56,831,584 (GRCm39)	N325S	probably damaging	Het
Tfcp2l1	C	A	1: 118,560,082 (GRCm39)	A58E	probably damaging	Het
Wdcp	T	C	12: 4,902,024 (GRCm39)		probably benign	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128,487,050 (GRCm39)	splice site	probably benign
IGL00704:Anapc1	APN	2	128,505,904 (GRCm39)	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128,471,649 (GRCm39)	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128,475,328 (GRCm39)	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128,495,090 (GRCm39)	missense	probably benign
IGL02089:Anapc1	APN	2	128,505,853 (GRCm39)	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128,501,772 (GRCm39)	missense	probably benign
IGL02570:Anapc1	APN	2	128,487,120 (GRCm39)	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128,465,851 (GRCm39)	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128,501,705 (GRCm39)	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128,469,117 (GRCm39)	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128,469,033 (GRCm39)	splice site	probably benign
IGL03327:Anapc1	APN	2	128,465,854 (GRCm39)	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128,520,138 (GRCm39)	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128,483,431 (GRCm39)	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128,483,431 (GRCm39)	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128,465,886 (GRCm39)	splice site	probably benign
R0103:Anapc1	UTSW	2	128,522,372 (GRCm39)	splice site	probably benign
R0103:Anapc1	UTSW	2	128,522,372 (GRCm39)	splice site	probably benign
R0109:Anapc1	UTSW	2	128,476,613 (GRCm39)	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128,476,613 (GRCm39)	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128,470,549 (GRCm39)	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128,470,549 (GRCm39)	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128,476,631 (GRCm39)	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128,483,260 (GRCm39)	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128,510,963 (GRCm39)	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128,474,575 (GRCm39)	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128,461,252 (GRCm39)	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128,459,651 (GRCm39)	missense	probably benign
R1175:Anapc1	UTSW	2	128,522,108 (GRCm39)	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128,459,617 (GRCm39)	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128,459,476 (GRCm39)	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128,466,819 (GRCm39)	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128,459,636 (GRCm39)	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128,470,452 (GRCm39)	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128,500,166 (GRCm39)	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128,518,128 (GRCm39)	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128,517,810 (GRCm39)	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128,501,708 (GRCm39)	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128,475,335 (GRCm39)	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128,511,608 (GRCm39)	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128,490,378 (GRCm39)	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128,484,468 (GRCm39)	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128,522,057 (GRCm39)	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128,484,602 (GRCm39)	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128,484,439 (GRCm39)	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128,469,149 (GRCm39)	intron	probably benign
R4359:Anapc1	UTSW	2	128,465,476 (GRCm39)	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128,518,169 (GRCm39)	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128,469,115 (GRCm39)	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128,505,925 (GRCm39)	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128,527,980 (GRCm39)	splice site	probably benign
R4824:Anapc1	UTSW	2	128,470,610 (GRCm39)	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128,526,514 (GRCm39)	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128,449,095 (GRCm39)	unclassified	probably benign
R5063:Anapc1	UTSW	2	128,471,469 (GRCm39)	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128,501,837 (GRCm39)	missense	probably benign
R5271:Anapc1	UTSW	2	128,527,905 (GRCm39)	nonsense	probably null
R5363:Anapc1	UTSW	2	128,492,114 (GRCm39)	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128,517,621 (GRCm39)	nonsense	probably null
R5473:Anapc1	UTSW	2	128,449,115 (GRCm39)	unclassified	probably benign
R5559:Anapc1	UTSW	2	128,522,354 (GRCm39)	nonsense	probably null
R5631:Anapc1	UTSW	2	128,499,137 (GRCm39)	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128,466,836 (GRCm39)	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128,448,957 (GRCm39)	unclassified	probably benign
R6226:Anapc1	UTSW	2	128,492,292 (GRCm39)	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128,514,055 (GRCm39)	nonsense	probably null
R6561:Anapc1	UTSW	2	128,505,919 (GRCm39)	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128,526,454 (GRCm39)	nonsense	probably null
R6799:Anapc1	UTSW	2	128,501,657 (GRCm39)	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128,501,688 (GRCm39)	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128,511,820 (GRCm39)	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128,490,601 (GRCm39)	splice site	probably null
R7041:Anapc1	UTSW	2	128,470,576 (GRCm39)	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128,457,350 (GRCm39)	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128,520,194 (GRCm39)	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128,516,522 (GRCm39)	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128,454,930 (GRCm39)	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128,516,604 (GRCm39)	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128,483,457 (GRCm39)	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128,526,528 (GRCm39)	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128,511,828 (GRCm39)	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128,516,513 (GRCm39)	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128,490,408 (GRCm39)	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128,474,547 (GRCm39)	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128,461,837 (GRCm39)	nonsense	probably null
R8402:Anapc1	UTSW	2	128,472,148 (GRCm39)	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128,517,757 (GRCm39)	missense	probably benign
R8425:Anapc1	UTSW	2	128,511,788 (GRCm39)	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128,500,264 (GRCm39)	splice site	probably null
R8688:Anapc1	UTSW	2	128,527,748 (GRCm39)	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128,483,373 (GRCm39)	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128,483,369 (GRCm39)	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128,499,093 (GRCm39)	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128,499,093 (GRCm39)	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128,464,333 (GRCm39)	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128,505,952 (GRCm39)	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128,483,322 (GRCm39)	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128,476,628 (GRCm39)	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128,464,426 (GRCm39)	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128,465,422 (GRCm39)	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128,464,420 (GRCm39)	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128,459,642 (GRCm39)	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128,476,598 (GRCm39)	missense	probably benign
R9436:Anapc1	UTSW	2	128,518,045 (GRCm39)	missense	probably benign
R9516:Anapc1	UTSW	2	128,517,633 (GRCm39)	missense	possibly damaging	0.77
R9563:Anapc1	UTSW	2	128,505,980 (GRCm39)	nonsense	probably null
R9572:Anapc1	UTSW	2	128,505,976 (GRCm39)	missense	probably benign
R9757:Anapc1	UTSW	2	128,517,676 (GRCm39)	missense	probably damaging	1.00
R9766:Anapc1	UTSW	2	128,500,221 (GRCm39)	missense	probably damaging	1.00
X0066:Anapc1	UTSW	2	128,516,621 (GRCm39)	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- CCAGAGTCAAATCCACAAGGGG -3'
(R):5'- CCGTTGTGTGAAAGCAGTAG -3'

Sequencing Primer
(F):5'- AATCCACAAGGGGGCCCAG -3'
(R):5'- TGTGTGAAAGCAGTAGGTAGAGTTC -3'

Posted On

2021-01-18