Incidental Mutation 'R8553:Eya4'
ID659979
Institutional Source Beutler Lab
Gene Symbol Eya4
Ensembl Gene ENSMUSG00000010461
Gene NameEYA transcriptional coactivator and phosphatase 4
SynonymsB130023L16Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8553 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location23102963-23350786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23106258 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 601 (H601Y)
Ref Sequence ENSEMBL: ENSMUSP00000151287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074366] [ENSMUST00000092665] [ENSMUST00000219315] [ENSMUST00000220299]
Predicted Effect probably damaging
Transcript: ENSMUST00000074366
AA Change: H601Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073970
Gene: ENSMUSG00000010461
AA Change: H601Y

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-163 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000092665
AA Change: H601Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090335
Gene: ENSMUSG00000010461
AA Change: H601Y

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-172 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000219315
AA Change: H624Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000220299
AA Change: H601Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator through its protein phosphatase activity, and it may be important for eye development, and for continued function of the mature organ of Corti. Mutations in this gene are associated with postlingual, progressive, autosomal dominant hearing loss at the deafness, autosomal dominant non-syndromic sensorineural 10 locus. The encoded protein is also a putative oncogene that mediates DNA repair, apoptosis, and innate immunity following DNA damage, cellular damage, and viral attack. Defects in this gene are also associated with dilated cardiomyopathy 1J. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show strain background-dependent postnatal lethality, reduced body weight, male sterility, a delay in palate bone fusion, developmental defects in the eustachian tube and middle ear cavity, early-onset hearing deficits, and profound susceptibility to otitis media with effusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,881,021 D176E probably benign Het
2210016F16Rik G A 13: 58,384,880 T92M probably damaging Het
4933427I04Rik A G 4: 123,860,534 I80M probably benign Het
Aga G A 8: 53,520,332 R255H probably damaging Het
Anapc1 G A 2: 128,619,913 P1757L possibly damaging Het
Arfgef3 T A 10: 18,603,530 I1446L probably damaging Het
Auts2 T C 5: 131,440,143 T779A probably benign Het
Cacna1s T C 1: 136,091,802 S778P possibly damaging Het
Cep164 A T 9: 45,807,210 probably benign Het
Cmya5 T C 13: 93,093,796 T1595A probably benign Het
Csmd3 G T 15: 47,621,328 T3214K possibly damaging Het
Dpy30 A G 17: 74,315,918 L23P probably damaging Het
Edrf1 A G 7: 133,650,318 E391G possibly damaging Het
Egflam A T 15: 7,207,748 V985E probably damaging Het
Elmo3 T C 8: 105,307,178 V201A probably benign Het
Epb41l5 T A 1: 119,549,941 D700V possibly damaging Het
Esr1 T C 10: 4,997,847 S467P probably damaging Het
Fam189b A C 3: 89,186,846 D322A possibly damaging Het
Fancm A C 12: 65,126,695 N1927T possibly damaging Het
Gcfc2 A G 6: 81,935,963 T248A probably benign Het
Gm29106 T A 1: 118,200,419 C614S probably damaging Het
Greb1 T C 12: 16,723,327 T249A probably benign Het
Hectd4 T C 5: 121,353,598 S3700P possibly damaging Het
Hr T C 14: 70,567,525 L950P probably damaging Het
Hsd3b3 T A 3: 98,743,889 T82S possibly damaging Het
Ifit2 C A 19: 34,573,138 A26E probably benign Het
Igsf9b A G 9: 27,333,443 D902G probably damaging Het
Itga4 G A 2: 79,301,061 R591Q probably damaging Het
Kcnb1 A T 2: 167,104,611 S772R possibly damaging Het
Klhl32 T A 4: 24,629,343 I213L probably benign Het
Lcn3 A T 2: 25,766,335 probably null Het
Lpin2 T A 17: 71,231,237 S293T probably damaging Het
Magi2 T C 5: 20,651,200 F840S probably benign Het
Myt1 G A 2: 181,797,551 E289K possibly damaging Het
Ndst4 A G 3: 125,710,107 S8G probably damaging Het
Nlrp4f T C 13: 65,195,438 D109G possibly damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Pcdhb12 C T 18: 37,437,634 A611V probably damaging Het
Pcif1 A T 2: 164,886,497 I225F probably damaging Het
Peli3 A G 19: 4,934,932 F150L probably damaging Het
Rfx7 A G 9: 72,611,804 T263A probably damaging Het
Rpn1 A G 6: 88,095,557 Y294C probably damaging Het
Rusc2 T A 4: 43,416,508 S605T probably benign Het
Sec23ip A C 7: 128,754,053 Q300P probably damaging Het
Sh2d3c A G 2: 32,745,913 T98A probably damaging Het
Siah3 T A 14: 75,525,627 I106K probably benign Het
Spns2 C T 11: 72,457,227 D305N probably damaging Het
Sult1a1 G T 7: 126,674,161 Q177K probably benign Het
Tas2r109 A G 6: 132,980,208 I253T probably benign Het
Tcof1 T C 18: 60,831,571 D661G possibly damaging Het
Tdrd1 A G 19: 56,843,152 N325S probably damaging Het
Tfcp2l1 C A 1: 118,632,352 A58E probably damaging Het
Wdcp T C 12: 4,852,024 probably benign Het
Other mutations in Eya4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Eya4 APN 10 23159097 missense probably benign 0.17
IGL00507:Eya4 APN 10 23157536 nonsense probably null
IGL01324:Eya4 APN 10 23116551 critical splice donor site probably null
IGL01350:Eya4 APN 10 23113974 missense possibly damaging 0.88
IGL01397:Eya4 APN 10 23139999 missense probably benign 0.01
IGL02682:Eya4 APN 10 23116600 missense probably damaging 1.00
IGL02688:Eya4 APN 10 23159110 missense probably benign 0.01
IGL03071:Eya4 APN 10 23323073 missense probably benign 0.07
R0420:Eya4 UTSW 10 23155963 missense possibly damaging 0.85
R1688:Eya4 UTSW 10 23123861 missense probably damaging 1.00
R2312:Eya4 UTSW 10 23106264 missense probably damaging 1.00
R3029:Eya4 UTSW 10 23123878 missense probably benign
R3853:Eya4 UTSW 10 23116676 missense probably damaging 1.00
R3872:Eya4 UTSW 10 23155972 missense probably damaging 0.97
R4113:Eya4 UTSW 10 23155951 missense probably damaging 0.98
R4210:Eya4 UTSW 10 23226800 critical splice donor site probably null
R4457:Eya4 UTSW 10 23116668 missense probably damaging 1.00
R4691:Eya4 UTSW 10 23140068 missense probably benign 0.03
R4894:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5345:Eya4 UTSW 10 23110048 missense probably benign 0.00
R5473:Eya4 UTSW 10 23163453 missense probably benign 0.02
R5547:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5698:Eya4 UTSW 10 23140077 missense possibly damaging 0.50
R5951:Eya4 UTSW 10 23155994 missense probably damaging 1.00
R5953:Eya4 UTSW 10 23151973 missense probably damaging 1.00
R6111:Eya4 UTSW 10 23140055 missense possibly damaging 0.67
R6413:Eya4 UTSW 10 23116826 missense probably damaging 1.00
R6460:Eya4 UTSW 10 23152012 missense probably benign 0.05
R7144:Eya4 UTSW 10 23173045 missense probably benign 0.00
R7169:Eya4 UTSW 10 23155947 missense probably benign 0.42
R7358:Eya4 UTSW 10 23123851 critical splice donor site probably null
R7549:Eya4 UTSW 10 23111658 missense probably damaging 1.00
R7791:Eya4 UTSW 10 23113926 missense probably damaging 1.00
R7793:Eya4 UTSW 10 23226816 missense probably benign
R8550:Eya4 UTSW 10 23106258 missense probably damaging 1.00
R8556:Eya4 UTSW 10 23106258 missense probably damaging 1.00
R8703:Eya4 UTSW 10 23163442 missense probably benign 0.00
Z1088:Eya4 UTSW 10 23113988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGGAGTTTTCATTCCGAG -3'
(R):5'- TGGTACTACCAGACTTCCACCTG -3'

Sequencing Primer
(F):5'- CGAGTATGATTTCATCCGTTAAGACC -3'
(R):5'- AGACTTCCACCTGTAGATGGC -3'
Posted On2021-01-18