Incidental Mutation 'R8553:Spns2'
ID659980
Institutional Source Beutler Lab
Gene Symbol Spns2
Ensembl Gene ENSMUSG00000040447
Gene Namespinster homolog 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8553 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location72451638-72489904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72457227 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 305 (D305N)
Ref Sequence ENSEMBL: ENSMUSP00000044418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045303]
Predicted Effect probably damaging
Transcript: ENSMUST00000045303
AA Change: D305N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044418
Gene: ENSMUSG00000040447
AA Change: D305N

DomainStartEndE-ValueType
low complexity region 5 53 N/A INTRINSIC
Pfam:Sugar_tr 104 308 7.6e-16 PFAM
Pfam:OATP 106 427 7.2e-13 PFAM
Pfam:MFS_1 108 476 2.7e-37 PFAM
transmembrane domain 506 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144940
SMART Domains Protein: ENSMUSP00000120722
Gene: ENSMUSG00000040447

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transporter of sphingosine 1-phosphate, a secreted lipid that is important in cardiovascular, immunological, and neural development. Defects in this gene are a cause of early onset progressive hearing loss. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit symblepharon and impaired egress of T and B cells from the thymus and bone marrow, respectively. Mice homozygous for a different knock-out allele exhibit abnormal immune system, abnormal eye morphology and absent pinna reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,881,021 D176E probably benign Het
2210016F16Rik G A 13: 58,384,880 T92M probably damaging Het
4933427I04Rik A G 4: 123,860,534 I80M probably benign Het
Aga G A 8: 53,520,332 R255H probably damaging Het
Anapc1 G A 2: 128,619,913 P1757L possibly damaging Het
Arfgef3 T A 10: 18,603,530 I1446L probably damaging Het
Auts2 T C 5: 131,440,143 T779A probably benign Het
Cacna1s T C 1: 136,091,802 S778P possibly damaging Het
Cep164 A T 9: 45,807,210 probably benign Het
Cmya5 T C 13: 93,093,796 T1595A probably benign Het
Csmd3 G T 15: 47,621,328 T3214K possibly damaging Het
Dpy30 A G 17: 74,315,918 L23P probably damaging Het
Edrf1 A G 7: 133,650,318 E391G possibly damaging Het
Egflam A T 15: 7,207,748 V985E probably damaging Het
Elmo3 T C 8: 105,307,178 V201A probably benign Het
Epb41l5 T A 1: 119,549,941 D700V possibly damaging Het
Esr1 T C 10: 4,997,847 S467P probably damaging Het
Eya4 G A 10: 23,106,258 H601Y probably damaging Het
Fam189b A C 3: 89,186,846 D322A possibly damaging Het
Fancm A C 12: 65,126,695 N1927T possibly damaging Het
Gcfc2 A G 6: 81,935,963 T248A probably benign Het
Gm29106 T A 1: 118,200,419 C614S probably damaging Het
Greb1 T C 12: 16,723,327 T249A probably benign Het
Hectd4 T C 5: 121,353,598 S3700P possibly damaging Het
Hr T C 14: 70,567,525 L950P probably damaging Het
Hsd3b3 T A 3: 98,743,889 T82S possibly damaging Het
Ifit2 C A 19: 34,573,138 A26E probably benign Het
Igsf9b A G 9: 27,333,443 D902G probably damaging Het
Itga4 G A 2: 79,301,061 R591Q probably damaging Het
Kcnb1 A T 2: 167,104,611 S772R possibly damaging Het
Klhl32 T A 4: 24,629,343 I213L probably benign Het
Lcn3 A T 2: 25,766,335 probably null Het
Lpin2 T A 17: 71,231,237 S293T probably damaging Het
Magi2 T C 5: 20,651,200 F840S probably benign Het
Myt1 G A 2: 181,797,551 E289K possibly damaging Het
Ndst4 A G 3: 125,710,107 S8G probably damaging Het
Nlrp4f T C 13: 65,195,438 D109G possibly damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Pcdhb12 C T 18: 37,437,634 A611V probably damaging Het
Pcif1 A T 2: 164,886,497 I225F probably damaging Het
Peli3 A G 19: 4,934,932 F150L probably damaging Het
Rfx7 A G 9: 72,611,804 T263A probably damaging Het
Rpn1 A G 6: 88,095,557 Y294C probably damaging Het
Rusc2 T A 4: 43,416,508 S605T probably benign Het
Sec23ip A C 7: 128,754,053 Q300P probably damaging Het
Sh2d3c A G 2: 32,745,913 T98A probably damaging Het
Siah3 T A 14: 75,525,627 I106K probably benign Het
Sult1a1 G T 7: 126,674,161 Q177K probably benign Het
Tas2r109 A G 6: 132,980,208 I253T probably benign Het
Tcof1 T C 18: 60,831,571 D661G possibly damaging Het
Tdrd1 A G 19: 56,843,152 N325S probably damaging Het
Tfcp2l1 C A 1: 118,632,352 A58E probably damaging Het
Wdcp T C 12: 4,852,024 probably benign Het
Other mutations in Spns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01733:Spns2 APN 11 72456510 missense possibly damaging 0.79
IGL01804:Spns2 APN 11 72457304 missense possibly damaging 0.89
elderly UTSW 11 72456370 critical splice acceptor site probably null
homely UTSW 11 72456860 missense probably damaging 1.00
whistler UTSW 11 72458687 nonsense probably null
Wrinkled UTSW 11 72456878 missense possibly damaging 0.81
R0883:Spns2 UTSW 11 72454397 missense probably damaging 1.00
R1544:Spns2 UTSW 11 72456367 missense probably benign 0.30
R1696:Spns2 UTSW 11 72456347 missense probably benign 0.25
R2046:Spns2 UTSW 11 72459040 missense possibly damaging 0.49
R2164:Spns2 UTSW 11 72458671 missense possibly damaging 0.82
R2259:Spns2 UTSW 11 72457268 missense probably benign 0.35
R4209:Spns2 UTSW 11 72454186 missense probably benign 0.07
R5285:Spns2 UTSW 11 72489479 missense possibly damaging 0.92
R6883:Spns2 UTSW 11 72456370 critical splice acceptor site probably null
R6990:Spns2 UTSW 11 72489621 missense probably benign 0.08
R7221:Spns2 UTSW 11 72456916 missense probably benign 0.43
R7227:Spns2 UTSW 11 72458687 nonsense probably null
R7243:Spns2 UTSW 11 72456860 missense probably damaging 1.00
R7390:Spns2 UTSW 11 72456878 missense possibly damaging 0.81
R7699:Spns2 UTSW 11 72489617 nonsense probably null
R7700:Spns2 UTSW 11 72489617 nonsense probably null
R8042:Spns2 UTSW 11 72454177 missense possibly damaging 0.46
R8155:Spns2 UTSW 11 72456568 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AAATGCGCTTTCTCAGGCCC -3'
(R):5'- TTAGCCTAGTAAAAGGGCCCG -3'

Sequencing Primer
(F):5'- TTTCTCAGGCCCAGCTGAG -3'
(R):5'- AGGTAAGTTGCCTGGGCC -3'
Posted On2021-01-18